TonB-dependent transporters and their occurrence in cyanobacteria

  • Oliver Mirus1,

    Affiliated with

    • Sascha Strauss2,

      Affiliated with

      • Kerstin Nicolaisen1,

        Affiliated with

        • Arndt von Haeseler2 and

          Affiliated with

          • Enrico Schleiff1Email author

            Affiliated with

            BMC Biology20097:68

            DOI: 10.1186/1741-7007-7-68

            Received: 29 May 2009

            Accepted: 12 October 2009

            Published: 12 October 2009

            Abstract

            Background

            Different iron transport systems evolved in Gram-negative bacteria during evolution. Most of the transport systems depend on outer membrane localized TonB-dependent transporters (TBDTs), a periplasma-facing TonB protein and a plasma membrane localized machinery (ExbBD). So far, iron chelators (siderophores), oligosaccharides and polypeptides have been identified as substrates of TBDTs. For iron transport, three uptake systems are defined: the lactoferrin/transferrin binding proteins, the porphyrin-dependent transporters and the siderophore-dependent transporters. However, for cyanobacteria almost nothing is known about possible TonB-dependent uptake systems for iron or other substrates.

            Results

            We have screened all publicly available eubacterial genomes for sequences representing (putative) TBDTs. Based on sequence similarity, we identified 195 clusters, where elements of one cluster may possibly recognize similar substrates. ForAnabaena sp. PCC 7120 we identified 22 genes as putative TBDTs covering almost all known TBDT subclasses. This is a high number of TBDTs compared to other cyanobacteria. The expression of the 22 putative TBDTs individually depends on the presence of iron, copper or nitrogen.

            Conclusion

            We exemplified on TBDTs the power of CLANS-based classification, which demonstrates its importance for future application in systems biology. In addition, the tentative substrate assignment based on characterized proteins will stimulate the research of TBDTs in different species. For cyanobacteria, the atypical dependence of TBDT gene expression on different nutrition points to a yet unknown regulatory mechanism. In addition, we were able to clarify a hypothesis of the absence of TonB in cyanobacteria by the identification of according sequences.

            Background

            Filamentous cyanobacteria contain molecular machines for oxygenic photosynthesis under all growth conditions [1]. These machines, as well as those involved in respiration and nitrogen metabolism, depend on non-proteinaceous cofactors such as iron [2, 3]. The level of iron found in cyanobacteria is generally one order of magnitude higher than in non-photosynthetic bacteria [4] and represents about 0.1% of their biomass [5]. Even though iron and copper are required for the function of respiratory and photosynthetic complexes, their intracellular level has to be tightly controlled as these ions pose a risk of oxidation [3]. Therefore, the uptake of iron is highly regulated in order to avoid intoxication. On the other hand, it is hypothesized that iron limitation might have been one of the selective forces in the evolution of cyanobacteria [6], and one might speculate that those cyanobacteria with the most efficient iron uptake systems might have had an evolutionary advantage. To enhance iron uptake, eubacteria secrete low-molecular-weight iron chelators (siderophores) under iron-limiting conditions to complex environmental iron [7]. The siderophore-iron complexes are bound by receptor proteins (TonB-dependent transporters, TBDTs) in the outer membrane which are composed of a transmembrane β-barrel domain, a so-called plug domain and a periplasmic exposed TonB box. The siderophore-iron is subsequently transferred to the cytoplasm by transport proteins in the cytoplasmic membrane [8, 9]. This process is dependent on TonB which provides the energy required for the translocation of siderophore-iron complexes across the outer membrane [10]. In order to facilitate this translocation, the periplasmic domain of TonB interacts with the TonB box of the loaded TBDT. It is proposed that TonB exerts a pulling force on the TonB box and, thereby, partially unfolds the plug domain enabling the translocation of the siderophore into the periplasmic space [11]. Several TBDTs have been identified. Beside the ones for iron transport [12, 13], TBDTs for nickel [14], disaccharides (for sucrose SuxA; [15], for maltose MalA; [16]), oligo- (CsuF; [17]), polysaccharides (SusC; [18]) or large degradation products of proteins (RagA; [19]) are described. The most intensively studied function of TBDTs is the iron uptake in Gram-negative bacteria. Three large classes are defined, namely transferrin-/lactoferrin-binding proteins, porphyrin and siderophore transporters [20]. In addition to the transport of iron across the outer membrane by TBDTs, an additional ferric iron uptake system is postulated, but the corresponding outer membrane receptor has not yet been identified [21]. The TBDTs TbpA (transferring-binding protein A) and LbpA (lactoferrin-binding protein A) facilitate the uptake of iron from transferrin/lactoferrin, respectively; the uptake is also assisted by the lipoproteins TbpB and LbpB which face the extracellular side [22]. The porphyrin-transporting TBDTs include HasR, HgbA, HmbR (heme; [12, 22]) and BtuB which transports the cobalt-complexing vitamin B12 (cobalamin [23]). Heme uptake is especially important in bacterial pathogens, where various heme-containing compounds are utilized [13]. The siderophore TBDTs are further sub-classified according to their substrate - that is the chemical nature of the siderophore they bind. Siderophores belong inter alia to hydroxamates, catecholates, phenolates, citrates or combinations thereof [9]. For example, the siderophore transporters FepA, ViuA and IroN recognize catecholates, FhuA, FoxA and FhuE hydroxamate and FecA citrate.

            The iron uptake system in cyanobacteria is not well understood. For the non-filamentous cyanobacteriumSynechocystis sp. PCC 6803 the TBDTs encoded bysll1206, sll1406, sll1409 andslr1490 were partially characterized [24, 25]. For filamentous cyanobacteria such asAnabaena sp. PCC 7120 (also termedNostoc sp. PCC 7120) only siderophore secretion [2628], and the influence of enhanced or reduced iron levels on the growth [2932], were investigated.Anabaena sp. PCC 7120 secretes the hydroxamate-type siderophore schizokinen, allegedly the only siderophore secreted [26, 27]. Only recently, a TBDT encoded byschT (alr0397) involved in the uptake of schizokinen was identified. The expression of the geneschT (alr0397) was mildly increased under a shortage of Fe3+. AschT knock-out mutant showed a moderate phenotype of iron starvation, and the characterization of its siderophore-dependent iron uptake demonstrated the function ofschT as a TonB-dependent schizokinen transporter [33].

            To learn more about iron transport systems in general and in cyanobacteria particularly we searched for genes coding for TBDTs based on previously experimentally characterized TBDTs. Subsequently, we assigned putative substrates for so far uncharacterized TBDTs, according to their sequence similarity to already known TBDTs. We observed a substantial difference in the number of TBDT genes in the analysed cyanobacteria. The expression pattern of the TBDT genes inAnabaena sp. PCC 7120 is analysed with respect to iron, copper and nitrogen availability.

            Results and discussion

            Classification of TonB-dependent transporters

            Ninety-eight TBDTs and the (putative) substrates (for example, metallophores or sugars) were extracted from the published literature (see Additional file 1) [1419, 22, 34124]. In order to classify the TBDTs with unknown substrates, we first searched for putative TBDTs in 686 sequenced genomes. We identified 4600 putative TBDTs in 347 species (see Additional file 2). Compared to previously published bioinformatic analyses [15, 125], we identified fewer sequences in the species which had been analysed in the past due to a more stringent cutoff (not shown). More specifically, within the species analysed by Koebnik, we selected seven sequences not previously identified, but did not consider 103 sequences [125]. A similar ratio was found when analysing the number of sequences selected by us from the species analysed by Blanvillainet al. (+22/-142; [15]), who selected 3020 sequences which resulted in a discrepancy of about 5%.

            We subsequently performed a cluster analysis of the identified sequences of putative TBDTs (see Methods) leading to 195 clusters with at least two sequences. Figure 1A shows the consensus tree used to highlight 'regions' on the two-dimensional sequence landscape. A region is marked by roman numerals if the substrate for at least one TBDT in this region is experimentally verified (expTBDTs) or predicted (pTBDTs), and marked by upper case letters if no substrate TBDT in the region is known (Figure 1). Figure 1B shows the expTBDT regions I-VII, XI, XII and XIII and the pTBDTs regions VIII, IX and X together with the uncharacterized regions A-N. Figure 2 shows an enlarged version of the dashed rectangle in Figure 1B. The colours describe the substrate that binds to the corresponding TBDTs. Figure 2 (bottom) shows a magnification of the expTBDTs regions, where the numbers refer to sequences with a known substrate (Additional file 1, [1419, 22, 34124]). In the following, we characterize the regions according to the 98 TBDTs that have been experimentally verified or predicted (Additional file 1, [1419, 22, 34124]).
            http://static-content.springer.com/image/art%3A10.1186%2F1741-7007-7-68/MediaObjects/12915_2009_Article_276_Fig1_HTML.jpg
            Figure 1

            Clustering of the sequences of putative TonB-dependent transporters (TBDTs). The sequences found by the described genome-wide searches were analysed by CLANs as depicted. (A) shows the consensus tree of the pair-wise mean cluster distances. The branches are coloured according to their respective bootstrap value in shades of grey as indicated by the legend in the middle of the tree. The numbers at each leaf are of the format 'x_y', where 'x' is the cluster number and 'y' the number of sequences belonging to this cluster. We have further indicated the transported substrates and the regions as shown in Figure 1B are marked by I to XII and A to N. Brackets indicate that the metal ion is known, but the metallophore has not yet been identified. An asterisk marks predicted substrates. (B) shows the result of two-dimensional clustering in CLANS. The regions from Figure 1A are marked by red polygons (containing at least a single exp/pTBDT) and red circles (no functionally characterized TBDT). Sequences with a high similarity (P-value < 10-90) are connected by lines coloured in shades of grey (the darker the smaller theP-value). The regions shown in Figure 2 (grey dashed line) and Figure 3 (grey dashed-dotted line) are highlighted.

            http://static-content.springer.com/image/art%3A10.1186%2F1741-7007-7-68/MediaObjects/12915_2009_Article_276_Fig2_HTML.jpg
            Figure 2

            Distribution of the sequences of characterized (experimental/predicted) TonB-dependent transporters (TBDTs). The grey dashed frame from Figure 1B is shown here containing expTBDTs and pTBDTs, which are marked by colored symbols and a number, which corresponds to the numbering in column 1 (see Additional file 1, [1419, 22, 34124]). Symbols are used to enhance the readability of the figures and are explained on the bottom right. The dashed frames are shown in a magnified view on the bottom. Circles define regions without functionally characterized TBDTs. For regions XI and XII the substrates are indicated on the left. The region numbering is explained in the text.

            Region I

            This consists of 19 clusters with at least five sequences and 10 of them have assigned functions which include porphyrin, lacto-/transferrin and nickel transporters (Figure 2). Cluster 11 contains the sequence of the copper chelate binding protein OprC (sequence 1, for references see Additional file 1, [1419, 22, 34124]). A group of clusters (15, 17, 18, 59, 86 and 107; sequences 11-28) are comprised of heme-transporting (HmbR) proteins. Remarkably, the two enterobactin (catecholate; see Additional file 1, [1419, 22, 34124]) transporters VctA (cluster 59; sequence 28) and FetA (cluster 15; sequence 27) are located within the porphyrin group. This finding corroborates the observation that VctA and FetA are, supposedly, involved in transporting porphyrin [126, 127]. In cluster 16, the LbpA or TbpA proteins are found (sequences 29, 30). There is also a small cluster (112) which contains nickel-transporting TBDTs with a single expTBDT (sequence 31, FrpB4).

            Region II

            This contains 20 clusters, three of them represented by expTBDTs (cluster 4, 12, 40). In cluster 4 the experimentally confirmed cobalt-complexing vitamin B12 transporter BtuB (sequence 32) is present. However, in the same cluster, and in clusters 160 and 165, predicted BtuBs were identified (sequences 33-39). Cluster 12 contains IrgA, BfrA or IroN sequences (No. 2-10) transporting enterobactin, DHBS (catecholate) or salmochelin (glycosylated catecholate). In addition, a myxochelin (catecholate) transporter (sequence 40, cluster 40) occurs in region II.

            Region III

            Cluster 10 is defined by sequences of the aerobactin/rhizobactin (Citrate-hydroxamate; see Additional file 1, [1419, 22, 34124]) transporters IutA and RhtA (sequence 41 and 42).

            Region IV

            The largest cluster in region IV (No. 82) contains the sequences of the ferric rhizoferrin (carboxylate) transporter RumA and the diferric dicitrate transporter FecA (sequences 44 and 45).

            Region V (sequences 46-71)

            This consists of nine clusters with three (clusters 0, 6, 7) of them containing expTBDTs and two pTBDTs (clusters 9, 25). This region mainly contains transporters for hydroxamate-type siderophores, such as desferrioxamine (hydroxamate; cluster 0, sequences 50, 51, 56), ferrichrome (hydroxamate; cluster 0, sequence 55), pseudobactin A (citrate-catecholate-hydroxamate; cluster 6, sequences 62, 63), pyochelin (phenolate; cluster 6, sequence 66), or anguibactin (catecholate-hydroxamate; cluster 7, sequences 69-71). Interestingly, the proteins for which sequences are found in cluster 9 (sequence 67, 68) are predicted to transport thiamin, whereas proteins 46 and 47 (cluster 25) are predicted to transport vitamin B12. The latter appears to be a false prediction as judged from the large distance to cluster 4 containing the experimentally confirmed BtuB. Setting an even lowerP-value (1E-100 instead of 1E-90) as the threshold for defining the clusters in CLANS leads to cluster 0 splitting up in the upper part with all hydroxamate-type TBDTs (including all cyanobacterial TBDTs of cluster 0) and the lower part containing phenolate-transporting TBDTs and VciA, which has been shown to transport neither heme, vibriobactin, enterobactin, ferrioxamine B, aerobactin nor shizokinen [77].

            Region VI

            This region represents transporters for phenolates, catecholates or hexylsulfate and contains several clusters. A hexylsulfate transporting TBDT (sequence 77) can be found in cluster 45, a vibriobactin (catecholate) transporter (sequence 74) in cluster 140 and proteins transporting yersiniabactin (phenolate; sequences 72, 73) in cluster 79. As already observed in region V, we also detected two sequences (75, 76) in cluster 118 that are putative thiamin transporters.

            Region VII (cluster 67)

            Cluster 67 contains SuxA (sequence 78), an experimentally verified sucrose transporter. Please note, that sequence 79 has been predicted to transport sucrose [15]. The prediction was based on the co-localization of the corresponding gene with the transcriptional regulator ScrR. Thus, our bioinformatic analysis provides additional evidence for the functional characterization.

            Region VIII (cluster 52)

            This region contains predicted nickel and cobalt TBDTs with unknown metallophore specificity and no representative of the expTBDTs.

            Region IX

            This consists of eight sequences in one cluster (No. 32), where two of the eight are putative thiamin transporters. However, proteins assigned as thiamin transporters were also found in regions V (sequences 67, 68, cluster 7) and VI (sequences 75 and 76, cluster 118). Their genes are co-localized on the genome with a cytoplasmic membrane transporter for thiamin (PnuT, [128]), however, the functional assignment remains to be proven.

            Region X

            This contains a TBDT predicted to transport cobalt-complexing vitamin B12 (sequence 43, cluster 166). However, it is far away from the BtuB cluster in region II (Figure 2). Hence, the assigned function should be experimentally confirmed.

            Region XI

            The region is clearly separated from the rest and contains cluster 26. The experimentally characterized TBDTs include oligosaccharide (CsuF, sequence 88), polysaccharide transporters (SusC, sequence 87) and transporters for degradation products of proteins (RagA, sequences 85-86). While many taxa are represented by sequences in the region I-X, region XI consists almost exclusively of bacteroidetes with the exception of one δ-proteobacterial sequence (gi|108757959,Myxococcus xanthus). Thus, sequences in this region may indicate a special adaptation of these organisms, which may be due to their lifestyle. Bacteroidetes are involved in food digestion in the intestinal tract of mammals. Hence a specific TBDT class for the uptake of substrates provided by the host seems plausible.

            Region XII

            This also appears as an outlier (Figure 2). It contains eight clusters (35, 62, 63, 72, 76, 88, 187 and 188) and only one expTBDT MalA (sequence 90, cluster 63) that transports maltodextrin. Seven pTBDTs are said to transport xylan, pectin or chito-oligosaccharides (No. 91-97; for references see Additional file 1, [1419, 22, 34124]), where sequences 91-96 belong to cluster 63 and sequence 97 to cluster 72. It appears that this region is composed of di- and oligosaccharide transporters. In line with this notion, the δ-proteobacterial TBDTs are from Myxobacteria (Myxococcus xanthus,Sorangium cellulosum), which are found on decaying plant material consuming their saccharides. Most of the sequences in this region stem from α- and γ-proteobacteria (18.4%, 76%) and a few bacteroidetes, δ- and β-proteobacteria taxa.

            Region XIII

            Positioned between region XI and the crowded area on the right side, this region is defined by a fibronectin-binding TBDT (sequence 98, cluster 41). As in most of the sequences in region XI, the sequences of this region consist almost exclusively of bacteroidetes. The close proximity of regions XI and XIII is consistent with the observed interaction of the TBDT with a glycoprotein.

            Other regions

            For regions I to XIII we were in the lucky position of being able to infer at least putative functions to ~3700 sequences. (The putative annotation can be viewed at http://​www.​cibiv.​at/​TBDT.) However, from the 4600 sequences from GenBank ~900 sequences remain in regions A-N, where we were unable to assign any function (Figure 1). While we cannot discuss potential substrates for clusters in regions A-N, we can at least point to some regions that show a peculiar taxonomic composition. In regions A and B sequences from mostly γ- (74%) and α-proteobacteria (19%), but also a few β-proteobacterial (5%) and bacteroidetes (1.5%), are present. Region C contains exclusively γ-proteobacterial sequences.

            Classification of TonB-dependent transporters in cyanobacteria

            One of our aims was the identification and classification of cyanobacterial TBDTs. Hence we searched for sequences of putative TBDTs in 32 cyanobacterial genomes (proteins listed according to their accession code (Table 1, column 1). We additionally extracted the automated annotation from GenBank (Table 1, column 2). At present, this annotation is mostly limited to CirA, FhuE or BtuB. Hence, we analysed the location of cyanobacterial sequences on the CLANS plot (Figure 3 shows the section of Figure 1B indicated by a grey box). All cyanobacterial TBDTs belong to regions with experimentally characterized TBDTs (see Figure 2 and dashed frames in Figure 3). To further confirm the classification determined with CLANS we also constructed a phylogenetic tree for the cyanobacterial sequences (Figure 4). Seven 'subtrees' (a-f) were identified and mapped to regions I-X.
            http://static-content.springer.com/image/art%3A10.1186%2F1741-7007-7-68/MediaObjects/12915_2009_Article_276_Fig3_HTML.jpg
            Figure 3

            Distribution of TonB-dependent transporters (TBDTs) found in genomes of cyanobacteria. Cyanobacterial sequences of TBDTs are highlighted and the containing frames are enlarged at the bottom. Dashed boxes indicate the dimensions shown in Figure 1. The colour code shows the different species as indicated in the right corner. The numbers are according to Table 1.

            http://static-content.springer.com/image/art%3A10.1186%2F1741-7007-7-68/MediaObjects/12915_2009_Article_276_Fig4_HTML.jpg
            Figure 4

            Distribution of cyanobacterial sequences. An alignment of sequences of TonB-dependent transporters listed in Table 1 was used to reconstruct a maximum likelihood phylogeny. Bootstrap values were calculated from 1000 phylogenetic trees. To indicate the probability of occurrence of an edge in these trees the edges are shown in shades of grey.

            Table 1

            Sequences used for the phylogenetic analysis of cyanobacteria

            Code

            Old

            New

            Spot

            Database code

            Species

            Am1 B0127

            BtuB

            BtuB

            26

            gi|158339996

            Acaryochloris marina MBIC11017

            Am1 3407

            CirA

            HutA

            3

            gi|158336543

             

            Am1 3358

            CirA

            IutA

            38

            gi|158336494

             

            Am1 A0170

            CirA

            ViuA

            50

            gi|158339820

             

            Am1 3383

            CirA

            ViuA

            49

            gi|158336519

             

            Am1 A0184

            Fiu

            FhuA

            58

            gi|158339834

             

            Am1 A0274

            FhuE

            FhuA

            57

            gi|158339535

             

            Am1 A0198

            -

            FhuA

            71

            gi|158339845

             

            Am1 A0157

            FhuE

            FhuA

            59

            gi|158339807

             

            Am1 3393

            FhuE

            FhuA

            72

            gi|158336529

             

            Am1 3398

            -

            FhuA

            65

            gi|158336534

             

            Am1 3403

            Fiu

            FhuA

            62

            gi|158336539

             

            Ava_B0148

            FhuE

            FhuA

            89

            gi|75812430

            Anabaena variabilis ATCC 29413

            Ava_B0150

            CirA

            FhuA

            88

            gi|75812432

             

            Ava_B0159

            BtuB

            FhuA

            82

            gi|75812441

             

            Ava_B0185

            CirA

            ViuA

            46

            gi|75812467

             

            Ava_B0217

            Fiu

            BtuB

            23

            gi|75812499

             

            Ava_B0218

            CirA

            IutA

            42

            gi|75812500

             

            Ava_C0010

            FhuE

            BtuB

            27

            gi|75812671

             

            Ava_1672

            CirA

            ViuA

            47

            gi|75907894

             

            Ava_2840

            CirA

            FhuA

            83

            gi|75909052

             

            Ava_4967

            BtuB

            FhuA

            84

            gi|75911163

             

            cce3039

            CirA

            FhuA

            54

            gi|172037952

            Cyanothece sp. CCY0110

            glr0280

            CirA

            ?

            7

            gi|37519849

            Gloeobacter violaceus PCC7421

            gll0302

            CirA

            IutA

            41

            gi|37519871

             

            gll0311

            -

            FhuA

            81

            gi|37519880

             

            gll0313

            -

            FhuA

            56

            gi|37519882

             

            gll0319

            -

            FhuA

            63

            gi|37519888

             

            glr0327

            CirA

            ViuA

            48

            gi|37519896

             

            gll0331

            FecA

            FhuA

            69

            gi|37519900

             

            gll0343

            CirA

            IutA

            36

            gi|37519912

             

            glr0349

            FhuE

            FhuA

            95

            gi|37519918

             

            glr0353

            -

            FhuA

            76

            gi|37519922

             

            gll0361

            FhuE

            FhuA

            78

            gi|37519930

             

            gll0896

            FepA

            BtuB

            22

            gi|37520465

             

            gll1276

            OMC

            BtuB

            20

            gi|37520845

             

            glr1304

            OMC

            BtuB

            17

            gi|37520873

             

            glr1380

            -

            -

            -

            gi|37520949

             

            glr1385

            -

            BtuB

            18

            gi|37520954

             

            glr1386

            CirA

            BtuB

            15

            gi|37520955

             

            gll1452

            BtuB

            BtuB

            25

            gi|37521021

             

            glr1488

            -

            BtuB

            12

            gi|37521057

             

            glr1610

            -

            ?

            8

            gi|37521179

             

            glr1909

            FhuE

            FhuA

            73

            gi|37521478

             

            gll1962

            -

            BtuB

            16

            gi|37521531

             

            glr1973

            BtuB

            BtuB

            29

            gi|37521542

             

            gll1978

            Fiu

            FhuA

            93

            gi|37521547

             

            glr2051

            FepA

            ?

            10

            gi|37521620

             

            glr2116

            BtuB

            BtuB

            24

            gi|37521685

             

            gll3103

            BtuB

            BtuB

            11

            gi|37522672

             

            glr3352

            OMCa

            BtuB

            19

            gi|37522921

             

            gll3601

            BtuB

            BtuB

            14

            gi|37523170

             

            gll3680

            BtuB

            ?

            9

            gi|37523249

             

            gll3974

            FhuE

            FhuA

            77

            gi|37523543

             

            gll3976

            CirA

            FhuA

            75

            gi|37523545

             

            glr4296

            CirA

            BtuB

            13

            gi|37523865

             

            NpunF1172

            -

            BtuB

            33

            gi|186681644

            Nostoc punctiforme PCC73102

            NpunF3454

            -

            FhuA

            94

            gi|186683610

             

            all1101

            -

            FhuA

            52

            gi|17228596

            Anabaena sp. PCC 7120

            all2148

            FhuE

            FhuA

            66

            gi|17229640

             

            all2158

            FhuE

            FhuA

            53

            gi|17229650

             

            all2236

            Fiu

            FhuA

            87

            gi|17229728

             

            all2610

            CirA

            FhuA

            67

            gi|17230102

             

            all2674

            Fiu

            FhuA

            70

            gi|17230166

             

            all3310

            BtuB

            BtuB

            21

            gi|17230802

             

            all4026

            CirA

            ViuA

            45

            gi|17231518

             

            all4924

            FhuE

            FhuA

            61

            gi|17232416

             

            alr0397

            CirA

            IutA

            40

            gi|17227893

             

            alr2153

            CirA

            HutA

            4

            gi|17229645

             

            alr2175

            -

            FhuA

            69

            gi|17229667

             

            alr2185

            Fiu

            FhuA

            51

            gi|17229677

             

            alr2209

            CirA

            IutA

            44

            gi|17229701

             

            alr2211

            CirA

            FhuA

            90

            gi|17229703

             

            alr2581

            CirA

            IutA

            43

            gi|17230073

             

            alr2588

            CirA

            FhuA

            74

            gi|17230080

             

            alr2592

            FhuE

            FhuA

            91

            gi|17230084

             

            alr2596

            FhuE

            FhuA

            64

            gi|17230088

             

            alr2626

            -

            FhuA

            79

            gi|17230118

             

            alr3242

            CirA

            HutA

            5

            gi|17230734

             

            alr4028

            +alr4029

            -

            BtuB

            32

            gi|17231520

            gi|17231521

             

            sll1206

            IutA

            IutA

            39

            gi|16329186

            Synechocystis sp. PCC6803

            sll1409

            FhuA

            FhuA

            80

            gi|16329191

             

            sll1406

            FhuA

            FhuA

            85

            gi|16329194

             

            slr1490

            FhuA

            FhuA

            68

            gi|16329201

             

            CYA_1108

            BtuB

            BtuB

            31

            gi|86605797

            Synechococcus sp.

            JA-3-3Ab

            CYA_2031

            CirA

            HutA

            1

            gi|86606671

             

            CYB_1330

            BtuB

            BtuB

            28

            gi|86608804

            Synechococcus sp.

            JA-2-3B'a(2-13)

            CYB_2727

            CirA

            HutA

            2

            gi|86610153

             

            SynpA0637

            BtuB

            BtuB

            30

            gi|170077260

            Synechococcus sp. PCC 7002

            SynpG0081

            CirA

            HutA

            6

            gi|170076551

             

            SynpG0006

            CirA

            IutA

            35

            gi|170076476

             

            SynpG0138

            CirA

            IutA

            37

            gi|170076608

             

            SynPG0089

            FhuE

            FhuA

            55

            gi|170076568

             

            SynpG0103

            FhuA

            FhuA

            86

            gi|170076573

             

            Nspu20875

            CirA

            FhuA

            92

            gi|119508873

            Nodularia spumigena

            CCY9414

            Nspu21611

            CirA

            IutA

            43

            gi|119509643

             

            Cwat6206*

            -

            FhuA

            1

            gi|67920343

            Crocosphaera watsonii WH8501

            The annotation of the sequences is indicated in column 1, the spot number according to Figure 3 is indicated in column 4; the initial annotation in the database is given in column 2; the classification according to Figure 3 using the name of a representative transporter of the related category is given in column 3; the accession code in column 5; and the source organism column 6.

            a(OMC, outer membrane channel; '*', incomplete sequence; '?', no clear assignment possible).

            The six sequences in subtree 'a' belong to region I (Figure 3, 4) and show a relation to heme transporters such as HutA (Figures 1, 2, sequence 13). The sequences are found inSynechococcus sp., Acaryochloris marina andAnabaena sp. PCC 7120 (see new assignment in Table 1, column 3). Subtrees 'b' and 'c' contain only sequences fromGloeobacter violaceus. Subtree 'b' is within region I and is equidistant to enterobactin and heme transporters. Thereby, a clear assignment to a characterized TBDT family appears currently impossible. Subtree 'd' is close to the BtuB transporter cluster (region II) (Figure 1). In this region we find sequences from most of the analysed cyanobacteria (8 of 12), suggesting that transporters with similarity to BtuB are common. Subtree 'e' (Figure 3, 4) represents transporters, which can clearly be assigned as specific for aerobactin/rhizobactin (IutA-/RhtA-type). Subtree 'f' represents sequences of transporters with the closest relation to FhuA-type transporters of cluster 0. The sequences of subtree 'g' (cluster 1), closely related to ViuA, are probably transporters for catecholates. The sequences of subtree 'g' are also close to cluster 118, which contains putative thiamin transporters. Nevertheless, since the two putative thiamin transporters have not yet been experimentally confirmed, we consider these cyanobacterial TBDTs to be iron transporters of the ViuA-type.

            Summarizing, the assignment of the cyanobacterial TBDTs to regions with functional characterization was successful with the exception of some TBDTs fromGloeobacter violaceus (subtrees 'b' and 'c'). Although BtuB-like transporters and hydroxamate-type metallophore transporters were found in cyanobacteria, we did not find FecA-type (diferric dicitrate) TBDTs, even though they occur in α-, β-, γ-, δ- and ε-proteobacteria, bacteroidetes and spirochaetes.

            Identification of TBDTs inAnabaena sp. PCC 7120

            In order to explore the cyanobacterial TBDTs in more detail we analysed the full genome ofAnabaena sp. PCC 7120. We identified 21 TBDT genes carrying the plug domain and β-barrel domain characteristic for TBDTs. In addition, we identified four genes (all2620, alr2179, all2578, alr4028) containing the plug domain of the TBDT, but an incomplete β-barrel domain. Downstream ofall2620 (Figure 5A) andalr4028 (Figure 5B) a gene coding for the 'missing part' of the β-barrel domain is present (all2619 andalr4029, respectively). Consequently, we checked the stop codon separating the two gene pairs. We confirmed the stop codon betweenall2620 andall2619 (Figure 5A) and could not identify a frame shift in the sequence of the region 500 bp upstream or downstream of the stop codon. If All2620 is, indeed, part of a TBDT it has to form a heterodimer. A putative interaction partner would be All2619. It would, therefore, be interesting to investigate the existence of such complex and to understand whether it is just a remnant of a genetic accident which led to a split of the TBDT gene inall2620 andall2619. In contrast toall2620 andall2619, foralr4028 andalr4029 we found a T to C exchange in the sequence when comparing our results with that of the deposited sequence. Hence, we conclude that the stop codon does not exist and that the two genesalr4028 andalr4029 encode one protein. Therefore, 22 TBDTs exist inAnabaena sp. PCC 7120.
            http://static-content.springer.com/image/art%3A10.1186%2F1741-7007-7-68/MediaObjects/12915_2009_Article_276_Fig5_HTML.jpg
            Figure 5

            The genomic structure of the loci coding for TonB-dependent transporters (TBDTs) inAnabaenasp. PCC 7120. For A-C, the genomic structure was excised from Cyanobase (http://​bacteria.​kazusa.​or.​jp/​cyano/​[148]) and the nomenclature of the colour code is given in C. White boxes indicate genes for which the name is given in the figure. (A) Shows the genomic orientation surroundingall2620 (top) and the sequencing profile of the region coding for the stop codon (in reverse orientation, bottom). (B) Shows the genomic orientation surroundingalr4028 (top) and the sequencing profile of the region coding for the stop codon (in reverse orientation, bottom). (C) The genomic organization surrounding the 22 other genes coding for TBDTs.

            For 19 TBDTs the genomic organization suggests the integration of the gene in an operon (Figure 5C). Twelve TBDTs are directly positioned behind a gene coding for a (putative) transcriptional regulator (Figure 5C, violet), and most of the (putative) operon structures contain genes coding for proteins involved in iron transport. The gene coding for a ViuA-type transporter is in a putative operon with subunits of a cytochrome D ubiquinol oxidase, which is rather unexpected, because, to date, a relation between this oxidase and iron transport has not been reported (Figure 5C). Of the BtuB transporters one is a single gene (all3310), whereas the other (the gene which we confirmed and which is still annotated asalr4028/alr4029) is in a rather typical genomic environment, namely in front of three genes encoding the periplasmic and the plasma membrane localized iron transport machinery. The same holds true for thehutA-like genealr3242. The otherhutA-like gene (alr2153) is in a putative operon with a gene encoding a tetracenomycin C synthesis protein and a gene of unknown function. Again, the relation between the TBDT and the downstream genes are rather questionable.

            Three genes are classified asiutA-like.alr0397 (schT) is single standing in the genome. Downstream ofalr2581 we found two genes coding for an unknown protein and a dicitrate binding protein, respectively.Alr2209 is a component of a large genomic region (~14 kbp,alr2208-alr2215) containing upstream a transcription regulator and downstream a cluster with three genes coding for periplasmic dicitrate binding proteins and onefhuA-like gene (alr2211). Thirteen of the 14fhuA-like genes are upstream of a gene coding for a protein annotated as dicitrate-binding. However, most of the genes found in the putative operons defined by the 14fhuA-like genes encode for proteins of unknown function. Three of thefhuA-like genes (alr2588, alr2592, alr2596) are in the same chromosomal region. Upstream of these, a gene coding a transcription regulator and downstream a gene encoding a dicitrate binding protein are found. However, the phylogenetic analysis (Figure 4) argues against recent gene duplication.

            Variations of the number of genes encoding TBDTs in cyanobacteria

            The results presented in Figures 3, 4, 5 and Table 1 show that the number of TBDTs varies among cyanobacteria. We found 22 TBDTs inAnabaena sp. PCC 7120, 10 inAnabaena variabilis, six inSynechococcus sp. PCC 7002, four inSynechocystis sp. PCC 6803, 33 inGloeobacter violaceus, but no TBDTs in the genomes of, for example,Prochlorococcus). This variation of the number of genes, however, does not reflect an elevated amount of outer membrane protein coding genes inAnabaena sp. PCC 7120, because such a variation is not found for other outer membrane proteins (Omp85, TolC, OstA and others; not shown). Furthermore, in a previous report, a correlation of the number of TBDTs to the number of open reading frames as, for example, for transporters in the cytoplasmic membrane [129] was not observed [128], which is supported by our analysis (not shown).

            TBDTs are regulated by TonB proteins. Hence, the large number of TBDTs leads to the question of whether each TBDT is regulated individually or (at least a sub-population of the TBDTs) in concert by one TonB protein. We, therefore, screened the genomes for the presence oftonB (Table 2). One to threetonB genes were detected. Hence, the number of TBDTs largely exceeds the number of TonB proteins. Please note that we identified a TonB-like protein (Slr1484) inSynechocystis sp. PCC 6803, which corrects a previous statement excluding the presence of a TonB-like protein in this species [130].
            Table 2

            TonB-like genes in cyanobacteria

            species

            No. TonBs

            Locus tag

            Acaryochloris marina MBIC11017

            2

            AM1_A0167, AM1_3413

            Anabaena variabilis ATCC 29413

            1

            Ava_2295

            Crocosphaera watsonii WH 8501

            1

            CwatDRAFT_6356

            Cyanothece sp. CCY0110

            2

            CY0110_08196, CY0110_24616

            Gloeobacter violaceus PCC 7421

            3

            glr1389, glr1815, glr2404

            Nodularia spumigena CCY9414

            1

            N9414_10453

            Nostoc punctiforme PCC 73102

            1

            Npun_F0783

            Anabaena sp. PCC 7120

            1

            all5036

            Synechococcus sp. PCC 7002

            2

            SYNPCC7002_G0090, SYNPCC7002_A2465

            Synechococcus sp. JA-3-3Ab

            1

            CYA_2030

            Synechococcus sp. JA-2-3B'a(2-13)

            1

            CYB_2726

            Synechocystis sp. PCC 6803

            1

            slr1484

            Expression of genes inAnabaena sp. coding for TBDTs

            We analysed the gene expression of the 22 TDBT genes and ofall2620, which only codes for the N-terminal portion of a TBDT (Figure 5A) inAnabaena sp. PCC 7120 (Figure 6). To this end,Anabaena sp. PCC 7120 was grown in normal medium (BG11), medium without iron (BG11-Fe), medium without copper (BG11-Cu) or medium lacking both (BG11-Fe-Cu). The presence of transcript was then determined by non-quantitative reverse transcription polymerase chain reaction (RT-PCR; primers are listed in Table 3). Iron and copper were chosen, because iron is known to be involved in the regulation of the gene expression of TBDTs and copper was recently found to induce an expression of a gene cluster involved in siderophore synthesis [131]. Remarkably, 13 TBDT-gene transcripts were present under normal growth conditions in such amounts that they could be amplified and visualized by RT-PCR (Figure 6A, lane 2; Figure 6C, grey lines and black dashed line). It should be noted that the absence of a transcript for the other genes might only reflect low transcript abundance. For 19 genes, we detected transcripts under Fe minus or/Cu minus conditions (Figure 6A lane 4, 6B, lane 1, 2). The analysis of the detection pattern revealed the following: (1) the genesall2148 andall2236, both hydroxamate-type TBDTs, were down-regulated upon iron and/or copper starvation compared to transcript levels under normal conditions; (2) the expression of seven genes (iutA-like genesalr2209 andalr2581, thebtuB-like genealr4028, thehutA-like genealr3242 and thefhuA-like genesall2674, all4924 andalr2592) not detected under normal growth conditions is increased in response to copper, but not iron, limitation in the BG11 medium (Figure 6B, lane 1). This is notable, because, for four of these seven genes, the expression in the absence of one metal-ion (either Cu or Fe) is higher than in the absence of both iron and copper. OneviuA-like gene (all4026) is expressed at a low level in BG11, but not in BG11 deficient of iron. An exclusive dependence of (upregulation of) expression in BG11 medium on iron limitation was only observed foralr0397 (iutA-like) andall2610 (fhuA-like).
            http://static-content.springer.com/image/art%3A10.1186%2F1741-7007-7-68/MediaObjects/12915_2009_Article_276_Fig6_HTML.jpg
            Figure 6

            Iron-dependent expression of TonB-dependent transporters (TBDTs) ofAnabaenasp. PCC 7120. (A)Anabaena sp. PCC 7120 were grown in media with (lane 1, 2, 5 and 6) and without a source of ferric ammonium citrate and copper (-Fe/-Cu, lane 3, 4, 7 and 8) as well as with (BG11, lane 1-4) and without a source of nitrogen (BG110, lane 5-8). RNA was isolated and RT-PCR was performed to visualize expression with (+) and without (-) addition of reverse transcriptase using primers listed in Table 3. The transcript ofrnpB was amplified as control. (B)Anabaena sp. PCC 7120 were grown in media with (BG11, lane 1, 2) or without nitrogen source (BG110, lane 3, 4) in the absence of either copper sulfate (lane 1, 3) or ferric ammonium citrate (lane 2, 4) and RNA isolated from 50 ml cells of log phase cultures as described. RT-PCR was performed to visualize expression with and without addition of reverse transcriptase using primers listed in Table 3. (C) The results from A and B are visualized as bar code where black stands for detected expression, and white for no expression detected under conditions used. The order is given on the right (C stands for: pointing to the centre). The black outer circle marks all genes expressed in BG110, the black dashed line all genes expressed in BG11, the black dashed dotted line all genes not expressed without starvation and the dotted line the gene only weakly expressed upon copper limitation in BG11. The grey line on the outer rim indicates all genes always expressed, the grey dashed line on the outer rim all genes where expression was not detected under one condition and the grey dashed dotted line on the outer rim all genes which are expressed in BG11 and BG110, but not in all other media.

            Table 3

            Primers used for reverse transcription polymerase chain reaction analysis and sequence confirmation.

            Use

            Primer

            Oligonucleotide sequence

            RT-PCR

            all1101-F

            CGCTGCTCTATCGCCTGACTG

             

            all1101-R

            GCGTACTTTCCAGCGATTGTGC

             

            all2148-F

            ACGGTGACGGGGGAAACAGGA

             

            all2148-R

            ACTTCCACTCGCTCAATCGTCC

             

            all2158-F

            CACCACCAGCAGAACCAACAGC

             

            all2158-R

            CGATAAATCCACCTCACCACGG

             

            all2236-F

            AATCGCGCGGCACTCTACCGT

             

            all2236-R

            GGATAACTCCAATCCCACGAGC

             

            all2610-F

            CAGTCATAGGAGAGGCGGGATT

             

            all2610-R

            CATAGAGTACAGAAGCCGGTCC

             

            all2620-F

            AAACTCCCTCAACCGCGCTGG

             

            all2620-R

            GGAATCCGCGAACCATCGGC

             

            all2674-F

            CCCAGAAACACCTACCGCAGAA

             

            all2674-R

            AACTAGGTTGACGACCCCACCT

             

            all3310-F

            TTTAGGCAACCCAGGCGGCAC

             

            all3310-R

            GCATTATGCTCAAAGGTGACGCG

             

            all4026-F

            GTGGTTTTTGTGGAGTGTGGGG

             

            all4026-R

            CCATCAACTGGTGTGTCTTCCC

             

            all4924-F

            CCCTACCAGAGGATCTGGGGA

             

            all4924-R

            CTGTACCAACGGCTGGTAAGAC

             

            alr0397-F

            TGCGTCGCGGGATTTGCGAAC

             

            alr0397-R

            GGATAGTATTGACCCTGGGGTC

             

            alr2153-F

            CCTCCCGTGGGATTAACTTTGG

             

            alr2153-R

            CGCATCAGGGCCCACTCGA

             

            alr2175-F

            GGTGTCCCGGCTGTTGGTACT

             

            alr2175-R

            AGTACCTCAAACCTCTCTGGGC

             

            alr2185-F

            CCCCGTCAGGTACTCGAAGAC

             

            alr2185-R

            TCTTCCATGTCAAGCTAGGGGC

             

            alr2209-F

            CCTACTCCCACACCCCCAAC

             

            alr2209-R

            CTGTCTTGGTCAGGTCTTCGGG

             

            alr2211-F

            CAAGATCGCCAAGTGGTGAGGC

             

            alr2211-R

            GTGTTTCCAGGTAACAAGCCCC

             

            alr2581-F

            GCGGGGACAGAAGGCAAATTTG

             

            alr2581-R

            CGCCTAATTGTTCTGTACCCCC

             

            alr2588-F

            CAGGTGAGGCGGGATTACCTG

             

            alr2588-R

            ACTCCCCCTGGTTCTAGTTGTC

             

            alr2592-F

            CCCCAAAGCCAGTGGAGGGA

             

            alr2592-R

            CCCCTAGCGGCTCGAACATTG

             

            alr2596-F

            CGCCTGTGCGCGATATTCCTG

             

            alr2596-R

            CAGGCGCAACAAATACCCGTTC

             

            alr2626-F

            GGCGTTCAACCAGGGGGAGT

             

            alr2626-R

            CTAAACCAGGTCTGGGTATGGC

             

            alr3242-F

            CCCGACGTGATAGTGGGTCAC

             

            alr3242-R

            CTGGGGGAATCCGGCTGCAT

             

            rnpB-F

            AGGGAGAGAGTAGG GTTGG

             

            rnpB-R

            GGTTTACCGAGCCAGTACCTCT

            Sequence confirmation

            all2619-20 F

            CTCCCATTTCTCCGAAGCTG

             

            all2619-20 R

            CAACGCTGGGGCCAACATAG

             

            alr4028-29 F

            CTATGGACTTAACCAACAAAGCATTC

             

            alr4028-29 R

            CTTCTCTGGTTTAAGGTCAGGATTAC

            Finally, we investigated the expression pattern of TDBTs under conditions enforcing heterocyst formation by growth in medium without a nitrogen source (BG110). We again analysed the amount of transcript in the four different media. Strikingly, in BG110 medium 17 genes are expressed (Figure 6A, lane 6, Figure 6C, black hemicircle) but seven of them are not expressed in BG11. Moreover, we found four genes -alr2153 andalr3242 (hutA-like),alr2626 andalr2185 (fhuA-like) - for which a transcript was detected only under additional metal starvation (BG110 -Fe, -Cu or -Fe/-Cu). Remarkably,all2620 is expressed under all conditions without a nitrogen source, which suggests thatall2620 is not a pseudogene. In general, one can conclude that not only metal starvation but also nitrogen starvation induces transcription of TBDT-encoding genes inAnabaena sp. PCC 7120.

            As onlyall5036 encodes a TonB-like protein inAnabaena sp. PCC 7120 we analysed its expression under the conditions outlined (Figure 7). As expected,all5036 transcript can be detected under all conditions tested. Assuming that the function of all identified TBDTs inAnabaena sp. depends on TonB, All5036 is required for iron homeostasis in general.
            http://static-content.springer.com/image/art%3A10.1186%2F1741-7007-7-68/MediaObjects/12915_2009_Article_276_Fig7_HTML.jpg
            Figure 7

            Expression ofall5036encoding the only TonB inAnabaenasp. PCC 7120.Anabaena sp. PCC 7120 were grown as for experiments shown in Figure 6 in BG11 (lane 1-4) or BG110 (lane 5-8) with and without a source of ferric ammonium citrate and/or copper and reverse transcription (RT) polymerase chain reaction was performed in the absence (-RT) or presence of reverse transcriptase on isolated RNA using primers for rnpB and all5036 (listed in Table 3) to visualize expression.

            Conclusion

            By clustering ~4,600 TBDTs we found that they group by their substrate and not according to their taxonomy with the exception of regions IX, XI, XIII and C. The latter are specific for sequences from bacteroidetes and γ-proteobacteria, respectively. Hence, the transported molecule dominates the sequence variation among TBDTs. According to the occurrence of expTBDTs within clusters, we were able to assign a tentative substrate for almost two-thirds of the analysed sequences. We have developed a website for a further detailed inspection of the clustering of individual sequences http://​www.​cibiv.​at/​TBDT. Here, the individual clusters or sequences can be highlighted based on the presentation in Figure 2. However, the current assignment has to be viewed with care as Schauer and colleagues pointed out that further substrates might be discovered in future [128], which will then be introduced into the web interface. We identified several clusters of TBDTs with putatively so far unknown substrates. Further research on a few candidate proteins of each of these clusters would be of great interest, as it would significantly advance the knowledge on substrate uptake by bacteria on the protein level and it might also reveal new potential drug targets.

            Large differences to previously suggested classifications were not observed for iron-transporting TBDTs. Generally, our approach resembles previous classifications of TBDTs according to their substrates based on a smaller number of sequences and a phylogenetic tree reconstruction [53, 80, 82, 111, 112], but the positioning of the IutA and of the ViuA sequences differs with respect to distances previously proposed [82, 112]. In contrast to the report by LeVier and Guerinot who placed ViuA between the lactoferrin and transferrin recognizing transporters [82], we found that ViuA (sequence 74, Region VI) clearly clusters with FyuA (sequence 72) sequences. This discrepancy might reflect the fact that: (i) more sequences of TBDTs are available nowadays; and (ii) the methodology to analyse sequence relationships has improved.

            A deviation from this general picture was found for the predicted BtuBs, which are spread over a long stripe from regions II to V. Hence, BtuBs might show a similar diffuse distribution pattern like the heme and hydroxamate transporters (regions I and V, respectively). The predicted BtuBs might, therefore, transport substrates only structurally related to cobalt-complexing vitamin B12.

            TBDTs inAnabaena sp

            Based on database searches, we have identified 25 sequences with TonB-box signature [39] leading to 22 sequences coding for putative TBDTs inAnabaena sp. PCC 7120 (Figures 3, 4, 5). Strikingly, at least five different types of transporters are identified (FhuA, ViuA, IutA, BtuB and HutA type) and this number greatly exceeds the number of genes coding for TBDTs of almost all other (sequenced) cyanobacteria with the exception ofGloeobacter violaceus. In turn, this is the only species for which some of the TBDTs could not be functionally assigned. As already discussed, it has been hypothesized that iron limitation might have been one of the selective forces in evolution of cyanobacteria.Gloeobacter violaceus (33 TBDTs) was isolated in 1972 from a calcareous rock near the Vierwaldstättersee in Switzerland, whereasAnabaena variablis (previouslyAnabaena flos-aquae strain A-37; 10 TBDTs) was isolated in 1964 from fresh water of the Mississippi, USA. Both strains are considered non-symbiotic.G. violaceus is rather unique with respect to the absence of thylakoid structure and does not form filaments [132] likeSynechocystis sp. PCC 6803 (4 TBDTs), which was isolated from fresh water in California and deposited in the Pasteur collection in 1968 http://​www.​crbip.​pasteur.​fr. Hence, the number of TBDTs does not correlate with filament or heterocyst formation. It might, however, correlate with the habitat from which the species were isolated, with respect to either species competition for iron or iron limitations in the environmentper se. Therefore, symbiotic cyanobacteria such asNostoc punctiforme may possibly contain a rather low number of TBDTs because iron is provided by the host. Unfortunately, to the best of our knowledge, the source ofAnabaena sp. strain PCC 7120 - formerly namedNostoc muscorum ISU ([133]; further synonyms areAnabaena sp. ATCC 27893,Nostoc sp. strain PCC 7120) - is unknown and it is considered to be a 'free living cyanobacterium'. The observation that this cyanobacterium is susceptible to viruses isolated from the Lake Mendota, Dane County, Wisconsin, USA, [133] might suggest that a similar environment was its place of isolation. This would be in line with an original natural habitat ofAnabaena sp. PCC 7120 that contained rather limited iron sources, because it has been reported that the iron concentration in rivers is higher than in lakes ([134]). The variety of TBDT classes found inAnabaena sp. rather agrees with iron limited environmental conditions. The only TBDT type which could not be identified in the analysed cyanobacterial species, in general, and, thereby, also inAnabaena sp. PCC 7120, is the FecA-type (diferric dicitrate) which can be found in many other bacteria. To date, schizokinen is the only confirmed siderophore which is secreted byAnabaena sp. PCC 7120 [27] and, recently, its transporter was identified [33]. However, additional siderophores are secreted byAnabaena sp. [33, 131], but they have not yet been characterized. Nevertheless, other interpretations for the variable number of TBDTs might still be possible.

            The environment influences the expression of TBDT genes inAnabaena sp

            In line with iron limitation in the native environment, several differential expression regulation regimes have been observed. For instance, six out of 14 genes encoding hydroxamate recognizing FhuA-like transporters are expressed under (almost) all tested conditions (Figure 6C, grey and grey dashed line, Table 1). The same holds true for one BtuB-like transporter encoded byall3310, which is in accordance with its identification in a proteome analysis of cells grown under standard conditions [135, 136]. Interestingly, the other BtuB-like transporter encoded by the joint geneall4028/all4029 is only expressed under iron-limiting conditions (Figure 6C, black dotted line). Furthermore, theiutA-like genes are always expressed under nitrogen-limiting conditions, whereashutA-like genes are only expressed upon metal starvation (Figure 6C, black dashed dotted line). Also, for the gene encoding the schizokinen transporter SchT (Alr0397) only a moderate and intermediate influence of iron starvation on expression was observed [33]. The gene encoding the only putative catecholate transporter (All4026) appears to be expressed under non-limiting conditions as well as after nitrogen starvation. To our surprise, we did not observe a transcript under iron limitation but under copper limitation in BG11 or in the absence of both metals in BG11 and BG110. Such a clear relation to copper starvation was detected for four FhuA-type transporters as well (Figure 6C). The relation between the expression of genes encoding for TBDTs inAnabaena sp. and copper agrees with the recent observation that genes involved in siderophore production are also induced by copper starvation [131]. Nevertheless, the components of the network regulating the expression of TBDT encoding genes still need to be identified. Even though a complex network of TBDTs was discovered, only a single TonB protein was found in 58% of Gram-negative bacteria [137]. The gene is expressed under all tested conditions and, hence, it has to be considered as a master 'regulator' of the large group of TBDTs.

            Methods

            Identification of TonB-dependent transporters

            Ninety-eight TBDT sequences were extracted from the NCBI database after extensive literature search. For 67 of them, experimental data is available, but for four of them the substrate is still unknown. Information on predicted substrates for the remaining 27 is available (see Additional file 1, [1419, 22, 34124]). These predictions are based on co-localization with genes of a specific metabolic pathway or on co-regulation by either transcription factors or a riboswitch [128]. Moreover, we downloaded 686 completely sequenced eubacterial genomes from the NCBI ftp server ftp://​ftp.​ncbi.​nih.​gov/​genomes/​Bacteria/​ that were available in June 2008. In order to locate putative TBDTs in the genomes, we searched for open reading frames containing the TBDT β-barrel domain and the plug domain. To this end, we used hmmsearch (hidden Markov model search) from the hmmer package http://​hmmer.​janelia.​org/​ and the profile hidden Markov models PF00593 and PF07715 provided by the PFAM database [138, 139]. The hmmsearch output-files were parsed considering only hits with anE-value < 10-10. We used only sequences for further analysis that resulted in a significant hit for both domains.

            Phylogenetic analysis and clustering

            The 97 cyanobacterial TBDT sequences were aligned with MAFFT [140] and a maximum likelihood tree was constructed with IQPNNI v3.3.b4 [141]. As a substitution model we selected VT [142] with gamma-distributed rate heterogeneity. Support values were calculated from 1000 bootstrap replicates. The consensus tree was reconstructed with Tree-Puzzle v5.2 [143] applying the majority consensus rule. The program CLANS [144] was used to cluster the 4648 putative TBDTs detected in the complete genomes, and to visualize their degree of similarity. In CLANS we set the cut off such that onlyP-values < 10-10 obtained by pairwise BLASTs were used for the CLANS-clustering. In the context of this manuscript, we use the term 'cluster' to refer to an aggregation of sequences. Each sequence in a cluster has at least one correspondent within the cluster with a BLAST p-value < 10-90 leading to 195 clusters with at least two elements.

            To further elucidate the relationship of the 195 clusters, we ran CLANS 100 times with a random initial configuration of the sequences in 3d space. In each run we determined the cluster centres and computed pair-wise distances between the centres. With the PHYLIP package v3.68 [145] we constructed a neighbour-joining tree for the resulting 100 distance matrices and we inferred the majority rule consensus tree with support values for the splits in the consensus tree.

            Genome loci of TonB-dependent transporters inAnabaena sp. PCC 7120

            The annotations of genes upstream and downstream of the TBDT loci, shown in Figure 5, were done manually.

            Analysis of the operon structure

            Genomic DNA ofAnabaena sp. was isolated as described [146]. The intergenic sequences betweenall2619 andall2620 and betweenalr4028 andalr4029, respectively, and additional ~250 bp inside each flanking gene were amplified with 5' Prime PCR Extender Polymerase (5' Prime, Hamburg, Germany) according to the manufacturer's protocol. The PCR product was cloned into pCR2.1 (Invitrogen, Karlsruhe, Germany), transformed into DH5α (GibcoBRL, Eggenstein, Deutschland) and the resulting plasmids purified for sequencing.

            RNA isolation and analysis

            Total RNA was isolated from 50 ml cells of log phase cultures (OD750 ≈ 2) as described [147]. RT-PCRs were performed according to the protocol of the Invitrogen SuperScript® III First-Strand Synthesis System for Random Hexamer Primers (Invitrogen, Carlsbad, USA). The used oligonucleotides are listed in Table 3.

            Abbreviations

            Hmmsearch: 

            hidden Markov model search

            LbpA: 

            lactoferrin-binding protein A

            RT-PCR: 

            reverse transcription polymerase chain reaction

            TbpA: 

            transferrin-binding protein A

            TBDT: 

            TonB-dependent transporter

            expTBDT: 

            experimentally characterized TBDT

            pTBDT: 

            TBDT with predicted substrate.

            Declarations

            Acknowledgements

            Financial support from the Deutsche Forschungsgemeinschaft (DFG, SFBTR1-C7, SFBTR1-A10) and the Volkswagenstiftung to ES, from Wiener Wissenschafts-, Forschung- und Technologiefonds (WWTF) and Deutsche Forschungsgemeinschaft (DFG, SPP 1174) to AvH is acknowledged.

            Authors’ Affiliations

            (1)
            Department of Biosciences, JWGU Frankfurt am Main, Cluster of Excellence Macromolecular Complexes, Centre of Membrane Proteomics
            (2)
            Center for Integrative Bioinformatics Vienna, Max F Perutz Laboratories, University of Vienna, Medical University of Vienna, Veterinary University of Vienna

            References

            1. Adams DG, Duggan PS: Heterocyst and akinete differentiation in cyanobacteria. New Phytol 1999,144:3–33.View Article
            2. Kustka A, Carpenter EJ, Sanudo-Wilhelmy SA: Iron and marine nitrogen fixation: progress and future directions. Res Microbiol 2002,153:255–262.PubMedView Article
            3. Shcolnick S, Keren N: Metal homeostasis in cyanobacteria and chloroplasts. Balancing benefits and risks to the photosynthetic apparatus. Plant Physiol 2006,141:805–810.PubMedView ArticlePubMed Central
            4. Keren N, Aurora R, Pakrasi HB: Critical roles of bacterioferritins in iron storage and proliferation of cyanobacteria. Plant Physiol 2004,135:1666–1673.PubMedView ArticlePubMed Central
            5. Roger PA, Tirol A, Ardales S, Watanabe I: Chemical composition of cultures and natural samples of N 2 -fixing blue-green algae from rice fields. Biol Fertil Solis 1986,2:131–146.
            6. Ting CS, Rocap G, King J, Chisholm SW: Cyanobacterial photosynthesis in the oceans: the origins and significance of divergent light-harvesting strategies. Trends Microbiol 2002,10:134–142.PubMedView Article
            7. Ferreira F, Straus NA: Iron deprivation in cyanobacteria. J Appl Phyc 1994,6:199–210.View Article
            8. Wandersman C, Delepelaire P: Bacterial iron sources: from siderophores to hemophores. Annu Rev Microbiol 2004,58:611–647.PubMedView Article
            9. Miethke M, Marahiel MA: Siderophore-based iron acquisition and pathogen control. Microbiol Mol Biol Rev 2007,71:413–451.PubMedView ArticlePubMed Central
            10. Andrews SC, Robinson AK, Rodriguez-Quinones F: Bacterial iron homeostasis. FEMS Microbiol Rev 2003,27:215–237.PubMedView Article
            11. Gumbart J, Wiener MC, Tajkhorshid E: Mechanics of FORCE PROPAGATION in TonB-dependent outer membrane transport. Biophys J 2007,93:496–504.PubMedView ArticlePubMed Central
            12. Clarke TE, Tari LW, Vogel HJ: Structural biology of bacterial iron uptake systems. Curr Top Med Chem 2001,1:7–30.PubMedView Article
            13. Lee BC: Quelling the red menace: haem capture by bacteria. Mol Microbiol 1995,18:383–390.PubMedView Article
            14. Schauer K, Gouget B, Carrière M, Labigne A, de Reuse H: Novel nickel transport mechanism across the bacterial outer membrane energized by the TonB/ExbB/ExbD machinery. Mol Microbiol 2007,63:1054–1068.PubMedView Article
            15. Blanvillain S, Meyer D, Boulanger A, Lautier M, Guynet C, Denancé N, Vasse J, Lauber E, Arlat M: Plant carbohydrate scavenging through tonb-dependent receptors: a feature shared by phytopathogenic and aquatic bacteria. PLoS ONE 2007,2:e224.PubMedView ArticlePubMed Central
            16. Neugebauer H, Herrmann C, Kammer W, Schwarz G, Nordheim A, Braun V: ExbBD-dependent transport of maltodextrins through the novel MalA protein across the outer membrane of Caulobacter crescentus. J Bacteriol 2005,187:8300–8311.PubMedView ArticlePubMed Central
            17. Cheng Q, Yu MC, Reeves AR, Salyers AA: Identification and characterization of a Bacteroides gene, csuF, which encodes an outer membrane protein that is essential for growth on chondroitin sulfate. J Bacteriol 1995,177:3721–3727.PubMedPubMed Central
            18. Reeves AR, D'Elia JN, Frias J, Salyers AA: A Bacteroides thetaiotaomicron outer membrane protein that is essential for utilization of maltooligosaccharides and starch. J Bacteriol 1996,178:823–830.PubMedPubMed Central
            19. Nagano K, Murakami Y, Nishikawa K, Sakakibara J, Shimozato K, Yoshimura F: Characterization of RagA and RagB in Porphyromonas gingivalis: study using gene-deletion mutants. J Med Microbiol 2007,56:1536–1548.PubMedView Article
            20. Braun V, Killmann H: Bacterial solutions to the iron-supply problem. Trends Biochem Sci 1999,24:104–109.PubMedView Article
            21. Cartron ML, Maddocks S, Gillingham P, Craven CJ, Andrews SC: Feo-transport of ferrous iron into bacteria. Biometals 2006,19:143–157.PubMedView Article
            22. Perkins-Balding D, Ratliff-Griffin M, Stojiljkovic I: Iron transport systems in Neisseria meningitidis . Microbiol Mol Biol Rev 2004,68:154–171.PubMedView ArticlePubMed Central
            23. Ferguson AD, Deisenhofer J: TonB-dependent receptors-structural perspectives. Biochim Biophys Acta 2002,1565:318–332.PubMedView Article
            24. Katoh H, Hagino N, Grossman AR, Ogawa T: Genes essential to iron transport in the cyanobacterium Synechocystis sp . strain PCC 6803. J Bacteriol 2001,183:2779–2784.PubMedView ArticlePubMed Central
            25. Singh AK, McIntyre LM, Sherman LA: Microarray analysis of the genome-wide response to iron deficiency and iron reconstitution in the cyanobacterium Synechocystis sp . PCC 6803. Plant Physiol 2003,132:1825–1839.PubMedView ArticlePubMed Central
            26. Simpson FB, Neilands JB: Siderochromes in cyanophyceae: isolation and characterization of schizokinen from Anabaena sp . J Phycol 1976,12:44–48.
            27. Goldman SJ, Lammers PJ, Berman MS, Sanders-Loehr J: Siderophore-mediated iron uptake in different strains of Anabaena sp . J Bacteriol 1983,156:1144–1150.PubMedPubMed Central
            28. Clarke SE, Stuart J, Sanders-Loehr J: Induction of siderophore activity in Anabaena spp. and its moderation of copper toxicity. Appl Environ Microbiol 1987,53:917–922.PubMedPubMed Central
            29. Massalski A, Laube VM, Kushner DJ: Effects of cadmium and copper on the ultrastructure of Ankistrodesmus braunii and Anabaena 7120. Microbial Ecol 1981,7:183–189.View Article
            30. Guikema JA, Sherman LA: Organization and function of chlorophyll in membranes of cyanobacteria during iron starvation. Plant Physiol 1983,73:250–256.PubMedView ArticlePubMed Central
            31. Hutber GN, Hutson KG, Rogers LJ: Effect of iron deficiency on levels of two ferredoxins and flavodoxin in a cyanobacterium. FEMS Microbiol Lett 1977,1:193–196.View Article
            32. Latifi A, Jeanjean R, Lemeille S, Havaux M, Zhang CC: Iron starvation leads to oxidative stress in Anabaena sp . strain PCC 7120. J Bacteriol 2005,187:6596–6598.PubMedView ArticlePubMed Central
            33. Nicolaisen K, Moslavac S, Samborski A, Valdebenito M, Hantke K, Maldener I, Muro-Pastor AM, Flores E, Schleiff E: Alr0397 is an outer membrane transporter for the siderophore schizokinen in Anabaena sp . strain PCC 7120. J Bacteriol 2008,190:7500–7507.PubMedView ArticlePubMed Central
            34. Yoneyama H, Nakae T: Protein C (OprC) of the outer membrane of Pseudomonas aeruginosa is a copper-regulated channel protein. Microbiol 1996,142:2137–2144.View Article
            35. Beall B, Sanden GN: A Bordetella pertussis fepA homologue required for utilization of exogenous ferric enterobactin. Microbiol 1995,141:3193–3205.View Article
            36. Pollack JR, Neilands JB: Enterobactin, an iron transport compound from Salmonella typhimurium . Biochem Biophys Res Commun 1970,38:989–992.PubMedView Article
            37. Ochsner UA, Johnson Z, Vasil ML: Genetics and regulation of two distinct haem-uptake systems, phu and has, in Pseudomonas aeruginosa . Microbiol 2000,146:185–198.
            38. Dean CR, Poole K: Cloning and characterization of the ferric enterobactin receptor gene (pfeA) of Pseudomonas aeruginosa . J Bacteriol 1993,175:317–324.PubMedPubMed Central
            39. Lundrigan MD, Kadner RJ: Nucleotide sequence of the gene for the ferrienterochelin receptor FepA in Escherichia coli . Homology among outer membrane receptors that interact with TonB. J Biol Chem 1986,261:10797–10801.PubMed
            40. Hantke K, Nicholson G, Rabsch W, Winkelmann G: Salmochelins, siderophores of Salmonella enterica and uropathogenic Escherichia coli strains, are recognized by the outer membrane receptor IroN. Proc Natl Acad Sci USA 2003,100:3677–3682.PubMedView ArticlePubMed Central
            41. Bister B, Bischoff D, Nicholson GJ, Valdebenito M, Schneider K, Winkelmann G, Hantke K, Süssmuth RD: The structure of salmochelins: C-glucosylated enterobactins of Salmonella enterica . Biometals 2004,17:471–481.PubMedView Article
            42. Carswell CL, Rigden MD, Baenziger JE: Expression, purification, and structural characterization of CfrA, a putative iron transporter from Campylobacter jejuni . J Bacteriol 2008,190:5650–5662.PubMedView ArticlePubMed Central
            43. Nau CD, Konisky J: Evolutionary relationship between the TonB-dependent outer membrane transport proteins: nucleotide and amino acid sequences of the Escherichia coli colicin I receptor gene. J Bacteriol 1989,171:1041–1047.PubMedPubMed Central
            44. Hantke K: Dihydroxybenzoylserine - a siderophore for E. coli . FEMS Microbiol Lett 1990,67:5–8.
            45. Goldberg MB, Boyko SA, Butterton JR, Stoebner JA, Payne SM, Calderwood SB: Characterization of a Vibrio cholerae virulence factor homologous to the family of TonB-dependent proteins. Mol Microbiol 1992,6:2407–2418.PubMedView Article
            46. Beall B, Hoenes T: An iron-regulated outer-membrane protein specific to Bordetella bronchiseptica and homologous to ferric siderophore receptors. Microbiol 1997,143:135–145.View Article
            47. Mey AR, Payne SM: Haem utilization in Vibrio cholerae involves multiple TonB-dependent haem receptors. Mol Microbiol 2001,42:835–849.PubMedView Article
            48. Henderson DP, Payne SM: Characterization of the Vibrio cholerae outer membrane heme transport protein HutA: sequence of the gene, regulation of expression, and homology to the family of TonB-dependent proteins. J Bacteriol 1994,176:3269–3277.PubMedPubMed Central
            49. Mazoy R, Osorio CR, Toranzo AE, Lemos ML: Isolation of mutants of Vibrio anguillarum defective in haeme utilisation and cloning of huvA, a gene coding for an outer membrane protein involved in the use of haeme as iron source. Arch Microbiol 2003,179:329–338.PubMed
            50. Lewis LA, Gray E, Wang YP, Roe BA, Dyer DW: Molecular characterization of hpuAB, the haemoglobin-haptoglobin-utilization operon of Neisseria meningitidis . Mol Microbiol 1997,23:737–749.PubMedView Article
            51. Stojiljkovic I, Hwa V, de Saint Martin L, O'Gaora P, Nassif X, Heffron F, So M: The Neisseria meningitidis haemoglobin receptor: its role in iron utilization and virulence. Mol Microbiol 1995,15:531–541.PubMedView Article
            52. Srikumar R, Mikael LG, Pawelek PD, Khamessan A, Gibbs BF, Jacques M, Coulton JW: Molecular cloning of haemoglobin-binding protein HgbA in the outer membrane of Actinobacillus pleuropneumoniae . Microbiol 2004,150:1723–1734.View Article
            53. Stojiljkovic I, Hantke K: Hemin uptake system of Yersinia enterocolitica : similarities with other TonB-dependent systems in gram-negative bacteria. EMBO J 1992,11:4359–4367.PubMedPubMed Central
            54. Hornung JM, Jones HA, Perry RD: The hmu locus of Yersinia pestis is essential for utilization of free haemin and haem-protein complexes as iron sources. Mol Microbiol 1996,20:725–739.PubMedView Article
            55. Torres AG, Payne SM: Haem iron-transport system in enterohaemorrhagic Escherichia coli O157:H7. Mol Microbiol 1997,23:825–833.PubMedView Article
            56. Mills M, Payne SM: Identification of shuA, the gene encoding the heme receptor of Shigella dysenteriae , and analysis of invasion and intracellular multiplication of a shuA mutant. Infect Immun 1997,65:5358–5363.PubMedPubMed Central
            57. Cope LD, Yogev R, Müller-Eberhard U, Hansen EJ: A gene cluster involved in the utilization of both free heme and heme:hemopexin by Haemophilus influenzae type b. J Bacteriol 1995,177:2644–2653.PubMedPubMed Central
            58. Thomas CE, Olsen B, Elkins C: Cloning and characterization of tdhA, a locus encoding a TonB-dependent heme receptor from Haemophilus ducreyi . Infect Immun 1998,66:4254–4262.PubMedPubMed Central
            59. Letoffe S, Ghigo JM, Wandersman C: Iron acquisition from heme and hemoglobin by a Serratia marcescens extracellular protein. Proc Natl Acad Sci USA 1994,91:9876–9880.PubMedView ArticlePubMed Central
            60. Furano K, Luke NR, Howlett AJ, Campagnari AA: Identification of a conserved Moraxella catarrhalis haemoglobin-utilization protein, MhuA. Microbiol 2005,151:1151–1158.View Article
            61. Carson SD, Klebba PE, Newton SM, Sparling PF: Ferric enterobactin binding and utilization by Neisseria gonorrhoeae . J Bacteriol 1999,181:2895–2901.PubMedPubMed Central
            62. Mey AR, Wyckoff EE, Oglesby AG, Rab E, Taylor RK, Payne SM: Identification of the Vibrio cholerae enterobactin receptors VctA and IrgA: IrgA is not required for virulence. Infect Immun 2002,70:3419–3426.PubMedView ArticlePubMed Central
            63. Biswas GD, Sparling PF: Characterization of lbpA, the structural gene for a lactoferrin receptor in Neisseria gonorrhoeae . Infect Immun 1995,63:2958–2967.PubMedPubMed Central
            64. Cornelissen CN, Biswas GD, Tsai J, Paruchuri DK, Thompson SA, Sparling PF: Gonococcal transferrin-binding protein 1 is required for transferrin utilization and is homologous to TonB-dependent outer membrane receptors. J Bacteriol 1992,174:5788–5797.PubMedPubMed Central
            65. Heller K, Kadner RJ: Nucleotide sequence of the gene for the vitamin B12 receptor protein in the outer membrane of Escherichia coli . J Bacteriol 1985,161:904–908.PubMedPubMed Central
            66. Rodionov DA, Vitreschak AG, Mironov AA, Gelfand MS: Comparative genomics of the vitamin B12 metabolism and regulation in prokaryotes. J Biol Chem 2003,278:41148–41159.PubMedView Article
            67. Silakowski B, Kunze B, Nordsiek G, Blöcker H, Höfle G, Müller R: The myxochelin iron transport regulon of the myxobacterium Stigmatella aurantiaca Sg a15. Eur J Biochem 2000,267:6476–6485.PubMedView Article
            68. Kunze B, Bedorf N, Kohl W, Höfle G, Reichenbach H: Myxochelin A, a new iron-chelating compound from Angiococcus disciformis (Myxobacterales). Production, isolation, physico-chemical and biological properties. J Antibiot (Tokyo) 1989,42:14–17.
            69. Krone WJA, Stegehuis F, Koningstein G, van Doorn C, Roosendaal B, de Graaf FK, Oudega B: Characterization of the pColV-K30 encoded cloacin DF13/aerobactin outer membrane receptor protein of Escherichia coli ; isolation and purification of the protein and analysis of its nucleotide sequence and primary structure. FEMS Microbiol Lett 1985,26:153–161.View Article
            70. Gibson F, Magrath DI: The isolation and characterization of a hydroxamic acid (aerobactin) formed by Aerobacter aerogenes 62-I. Biochim Biophys Acta 1969,192:175–184.PubMed
            71. Lynch D, O'Brien J, Welch T, Clarke P, Cuiv PO, Crosa JH, O'Connell M: Genetic organization of the region encoding regulation, biosynthesis, and transport of rhizobactin 1021, a siderophore produced by Sinorhizobium meliloti . J Bacteriol 2001,183:2576–2585.PubMedView ArticlePubMed Central
            72. Persmark M, Pittman P, Buyer JS, Schwyn B, Gill PR, Neilands JB: Isolation and structure of rhizobactin 1021, a siderophore from the alfalfa symbiont Rhizobium meliloti 1021. J Am Chem Soc 1993,115:3950–3956.View Article
            73. Kühn S, Braun V, Köster W: Ferric rhizoferrin uptake into Morganella morganii : characterization of genes involved in the uptake of a polyhydroxycarboxylate siderophore. J Bacteriol 1996,178:496–504.PubMedPubMed Central
            74. Drechsel H, Metzger J, Freund S, Jung G, Boelaert JR, Winkelmann G: Rhizoferrin -- a novel siderophore from the fungus Rhizopus microsporus var. rhizopodiformis. BioMetals 1991,4:238–243.
            75. Pressler U, Staudenmaier H, Zimmermann L, Braun V: Genetics of the iron dicitrate transport system of Escherichia coli . J Bacteriol 1988,170:2716–2724.PubMedPubMed Central
            76. Ferguson AD, Chakraborty R, Smith BS, Esser L, Helm D, Deisenhofer J: Structural basis of gating by the outer membrane transporter FecA. Science 2002,295:1715–1719.PubMedView Article
            77. Mey AR, Wyckoff EE, Hoover LA, Fisher CR, Payne SM: Vibrio cholerae VciB promotes iron uptake via ferrous iron transporters. J Bacteriol 2008,190:5953–5962.PubMedView ArticlePubMed Central
            78. Ochsner UA, Vasil ML: Gene repression by the ferric uptake regulator in Pseudomonas aeruginosa : cycle selection of iron-regulated genes. Proc Natl Acad Sci USA 1996,93:4409–4414.PubMedView ArticlePubMed Central
            79. Cox CD, Rinehart KL Jr, Moore ML, Cook JC Jr: Pyochelin: novel structure of an iron-chelating growth promoter for Pseudomonas aeruginosa . Proc Natl Acad Sci USA 1981,78:4256–4260.PubMedView ArticlePubMed Central
            80. Bäumler AJ, Hantke K: Ferrioxamine uptake in Yersinia enterocolitica : characterization of the receptor protein FoxA. Mol Microbiol 1992,6:1309–1321.PubMedView Article
            81. Keller-Schierlein W, Prelog V: Stoffwechselprodukte von Actinomyceten. 29. Mitteilung. Die Konstitution des Ferrioxamins D1. Helv Chim Acta 1961,44:709–713.View Article
            82. LeVier K, Guerinot ML: The Bradyrhizobium japonicum fegA gene encodes an iron-regulated outer membrane protein with similarity to hydroxamate-type siderophore receptors. J Bacteriol 1996,178:7265–7275.PubMedPubMed Central
            83. Sauvage C, Franza T, Expert D: Analysis of the Erwinia chrysanthemi ferrichrysobactin receptor gene: resemblance to the Escherichia coli fepA-fes bidirectional promoter region and homology with hydroxamate receptors. J Bacteriol 1996,178:1227–1231.PubMedPubMed Central
            84. Persmark M, Expert D, Neilands JB: Isolation, characterization, and synthesis of chrysobactin, a compound with siderophore activity from Erwinia chrysanthemi . J Biol Chem 1989,264:3187–3193.PubMed
            85. Alice AF, López CS, Lowe CA, Ledesma MA, Crosa JH: Genetic and transcriptional analysis of the siderophore malleobactin biosynthesis and transport genes in the human pathogen Burkholderia pseudomallei K96243. J Bacteriol 2006,188:1551–1566.PubMedView ArticlePubMed Central
            86. Yang HM, Chaowagul W, Sokol PA: Siderophore production by Pseudomonas pseudomallei . Infect Immun 1991,59:776–780.PubMedPubMed Central
            87. Sokol PA, Darling P, Lewenza S, Corbett CR, Kooi CD: Identification of a siderophore receptor required for ferric ornibactin uptake in Burkholderia cepacia . Infect Immun 2000,68:6554–6560.PubMedView ArticlePubMed Central
            88. Stephan H, Freund S, Beck W, Jung G, Meyer JM, Winkelmann G: Ornibactins--a new family of siderophores from pseudomonas. Biometals 1993,6:93–100.PubMedView Article
            89. Coulton JW, Mason P, Cameron DR, Carmel G, Jean R, Rode HN: Protein fusions of beta-galactosidase to the ferrichrome-iron receptor of Escherichia coli K-12. J Bacteriol 1986,165:181–192.PubMedPubMed Central
            90. Zalkin A, Forrester JD, Templeton DH: Crystal and molecular structure of ferrichrome A. Science 1964,146:261–263.PubMedView Article
            91. Llamas MA, Sparrius M, Kloet R, Jiménez CR, Vandenbroucke-Grauls C, Bitter W: The heterologous siderophores ferrioxamine B and ferrichrome activate signaling pathways in Pseudomonas aeruginosa . J Bacteriol 2006,188:1882–1891.PubMedView ArticlePubMed Central
            92. Pradel E, Locht C: Expression of the putative siderophore receptor gene bfrZ is controlled by the extracytoplasmic-function sigma factor BupI in Bordetella bronchiseptica . J Bacteriol 2001,183:2910–2917.PubMedView ArticlePubMed Central
            93. Brito B, Aldon D, Barberis P, Boucher C, Genin S: A signal transfer system through three compartments transduces the plant cell contact-dependent signal controlling Ralstonia solanacearum hrp genes. Mol Plant Microbe Interact 2002,15:109–119.PubMedView Article
            94. Morris J, Donnelly DF, O'Neill E, McConnell F, O'Gara F: Nucleotide sequence analysis and potential environmental distribution of a ferric pseudobactin receptor gene of Pseudomonas sp . strain M114. Mol Gen Genet 1994,242:9–16.PubMed
            95. Teintze M, Leong J: Structure of pseudobactin A, a second siderophore from plant growth promoting Pseudomonas B10 . Biochemistry 1981,20:6457–6462.PubMedView Article
            96. Poole K, Neshat S, Krebes K, Heinrichs DE: Cloning and nucleotide sequence analysis of the ferripyoverdine receptor gene fpvA of Pseudomonas aeruginosa . J Bacteriol 1993,175:4597–4604.PubMedPubMed Central
            97. Philson SB, Llinás M: Siderochromes from Pseudomonas fluorescens . II. Structural homology as revealed by NMR spectroscopy. J Biol Chem 1982,257:8086–8090.PubMed
            98. Bitter W, Marugg JD, de Weger LA, Tommassen J, Weisbeek PJ: The ferric-pseudobactin receptor PupA of Pseudomonas putida WCS358: homology to TonB-dependent Escherichia coli receptors and specificity of the protein. Mol Microbiol 1991,5:647–655.PubMedView Article
            99. Koster M, Vossenberg J, Leong J, Weisbeek PJ: Identification and characterization of the pupB gene encoding an inducible ferric-pseudobactin receptor of Pseudomonas putida WCS358. Mol Microbiol 1993,8:591–601.PubMedView Article
            100. Brickman TJ, Armstrong SK: Essential role of the iron-regulated outer membrane receptor FauA in alcaligin siderophore-mediated iron uptake in Bordetella species . J Bacteriol 1999,181:5958–5966.PubMedPubMed Central
            101. Nishio T, Tanaka N, Hiratake J, Katsube Y, Ishida Y, Oda J: Isolation and structure of the novel dihydroxamate siderophore alcaligin. J Am Chem Soc 1988,110:8733–8734.View Article
            102. Sauer M, Hantke K, Braun V: Sequence of the fhuE outer-membrane receptor gene of Escherichia coli K12 and properties of mutants. Mol Microbiol 1990,4:427–437.PubMedView Article
            103. Atkin CL, Neilands JB: Rhodotorulic acid, a diketopiperazine dihydroxamic acid with growth-factor activity. I. Isolation and characterization. Biochemistry 1968,7:3734–3739.PubMedView Article
            104. Charlang G, Ng B, Horowitz NH, Horowitz RM: Cellular and extracellular siderophores of Aspergillus nidulans and Penicillium chrysogenum . Mol Cell Biol 1981,1:94–100.PubMedPubMed Central
            105. Dhungana S, White PS, Crumbliss AL: Crystal structure of ferrioxamine B: a comparative analysis and implications for molecular recognition. J Biol Inorg Chem 2001,6:810–818.PubMedView Article
            106. Ankenbauer RG, Quan HN: FptA, the Fe(III)-pyochelin receptor of Pseudomonas aeruginosa : a phenolate siderophore receptor homologous to hydroxamate siderophore receptors. J Bacteriol 1994,176:307–319.PubMedPubMed Central
            107. Rodionov DA, Vitreschak AG, Mironov AA, Gelfand MS: Comparative genomics of thiamin biosynthesis in procaryotes. New genes and regulatory mechanisms. J Biol Chem 2002,277:48949–48959.PubMedView Article
            108. Actis LA, Tolmasky ME, Farrell DH, Crosa JH: Genetic and molecular characterization of essential components of the Vibrio anguillarum plasmid-mediated iron-transport system. J Biol Chem 1988,263:2853–2860.PubMed
            109. Wuest WM, Sattely ES, Walsh CT: Three siderophores from one bacterial enzymatic assembly line. J Am Chem Soc 2009,131:5056–5057.PubMedView ArticlePubMed Central
            110. Dorsey CW, Tomaras AP, Connerly PL, Tolmasky ME, Crosa JH, Actis LA: The siderophore-mediated iron acquisition systems of Acinetobacter baumannii ATCC 19606 and Vibrio anguillarum 775 are structurally and functionally related. Microbiol 2004,150:3657–3667.View Article
            111. Koebnik R, Hantke K, Braun V: The TonB-dependent ferrichrome receptor FcuA of Yersinia enterocolitica : evidence against a strict co-evolution of receptor structure and substrate specificity. Mol Microbiol 1993,7:383–393.PubMedView Article
            112. Rakin A, Saken E, Harmsen D, Heesemann J: The pesticin receptor of Yersinia enterocolitica : a novel virulence factor with dual function. Mol Microbiol 1994,13:253–263.PubMedView Article
            113. Drechsel H, Stephan H, Lotz R, Haag H, Zähner H, Hantke K, Jung G: Structure elucidation of yersiniabactin, a siderophore from highly virulent Yersinia strains. Liebigs Annalen 1995,10:1727–1733.View Article
            114. Fetherston JD, Lillard JW Jr, Perry RD: Analysis of the pesticin receptor from Yersinia pestis : role in iron-deficient growth and possible regulation by its siderophore. J Bacteriol 1995,177:1824–1833.PubMedPubMed Central
            115. Butterton JR, Stoebner JA, Payne SM, Calderwood SB: Cloning, sequencing, and transcriptional regulation of viuA, the gene encoding the ferric vibriobactin receptor of Vibrio cholerae . J Bacteriol 1992,174:3729–3738.PubMedPubMed Central
            116. Griffiths GL, Sigel SP, Payne SM, Neilands JB: Vibriobactin, a siderophore from Vibrio cholerae . J Biol Chem 1984,259:383–385.PubMed
            117. Kahnert A, Kertesz MA: Characterization of a sulfur-regulated oxygenative alkylsulfatase from Pseudomonas putida S-313. J Biol Chem 2000,275:31661–31667.PubMedView Article
            118. Rodionov DA, Hebbeln P, Gelfand MS, Eitinger T: Comparative and functional genomic analysis of prokaryotic nickel and cobalt uptake transporters: evidence for a novel group of ATP-binding cassette transporters. J Bacteriol 2006,188:317–327.PubMedView ArticlePubMed Central
            119. Hoffman P, Linker A, Lippman V, Meyer K: The structure of chondroitin sulfate B from studies with Flavobacterium enzymes. J Biol Chem 1960,235:3066–3069.PubMed
            120. Atkins ED, Sheehan JK: The molecular structure of hyaluronic acid. Biochem J 1971,125:92.
            121. Wei B, Dalwadi H, Gordon LK, Landers C, Bruckner D, Targan SR, Braun J: Molecular cloning of a Bacteroides caccae TonB-linked outer membrane protein identified by an inflammatory bowel disease marker antibody. Infect Immun 2001,69:6044–6054.PubMedView ArticlePubMed Central
            122. Yang C, Rodionov DA, Li X, Laikova ON, Gelfand MS, Zagnitko OP, Romine MF, Obraztsova AY, Nealson KH, Osterman AL: Comparative genomics and experimental characterization of N-acetylglucosamine utilization pathway of Shewanella oneidensis . J Biol Chem 2006,281:29872–29885.PubMedView Article
            123. Karlsen S, Hough E: Crystal structures of three complexes between chito-oligosaccharides and lysozyme from the rainbow trout. How distorted is the NAG sugar in site D? Acta Crystallogr D Biol Crystallogr 1995,51:962–978.PubMedView Article
            124. Pauer H, Ferreira Ede O, dos Santos-Filho J, Portela MB, Zingali RB, Soares RM, Domingues RM: A TonB-dependent outer membrane protein as a Bacteroides fragilis fibronectin-binding molecule. FEMS Immunol Med Microbiol 2009,55:388–395.PubMedView Article
            125. Koebnik R: TonB-dependent trans-envelope signalling: the exception or the rule? Trends Microbiol 2005,13:343–347.PubMedView Article
            126. Beucher M, Sparling PF: Cloning, sequencing, and characterization of the gene encoding FrpB, a major iron-regulated, outer membrane protein of Neisseria gonorrhoeae . J Bacteriol 1995,177:2041–2049.PubMedPubMed Central
            127. Mey AR, Payne SM: Haem utilization in Vibrio cholerae involves multiple TonB-dependent haem receptors. Mol Microbiol 2001,42:835–849.PubMedView Article
            128. Schauer K, Rodionov DA, de Reuse H: New substrates for TonB-dependent transport: do we only see the 'tip of the iceberg'? Trends Biochem Sci 2008,33:330–338.PubMedView Article
            129. Ren Q, Paulsen IT: Comparative analyses of fundamental differences in membrane transport capabilities in prokaryotes and eukaryotes. PLoS Comput Biol 2005,1:e27.PubMedView ArticlePubMed Central
            130. Huang F, Parmryd I, Nilsson F, Persson AL, Pakrasi HB, Andersson B, Norling B: Proteomics of Synechocystis sp . strain PCC 6803: identification of plasma membrane proteins. Mol Cell Proteomics 2002,1:956–966.PubMedView Article
            131. Jeanjean R, Talla E, Latifi A, Havaux M, Janicki A, Zhang CC: A large gene cluster encoding peptide synthetases and polyketide synthases is involved in production of siderophores and oxidative stress response in the cyanobacterium Anabaena sp . strain PCC 7120. Environ Microbiol 2008,10:2574–2585.PubMedView Article
            132. Guglielmi G, Cohen-Bazire G, Bryant DA: The structure of Gloeobacter violaceus and its phycobilisomes. Arch Microbiol 1981,129:181–189.View Article
            133. Adolph KW, Haselkorn R: Isolation and characterization of a virus infecting the blue-green alga Nostoc muscorum . Virology 1971,46:200–208.PubMedView Article
            134. Dean WE, Neff BP, Rosenberry DO, Winter TC, Parkhurst R: The significance of ground water to the accumulation of iron and manganese in the sediments of two hydrologically distinct lakes in North-Central Minnesota: A geological perspective. Ground Water 2003,41:951–963.View Article
            135. Moslavac S, Bredemeier R, Mirus O, Granvogl B, Eichacker LA, Schleiff E: Proteomic analysis of the outer membrane of Anabaena sp . strain PCC 7120. J Proteome Res 2005,4:1330–1338.PubMedView Article
            136. Moslavac S, Reisinger V, Berg M, Mirus O, Vosyka O, Plöscher M, Flores E, Eichacker LA, Schleiff E: The proteome of the heterocyst cell wall in Anabaena sp . PCC 7120. Biol Chem 2007,388:823–829.PubMedView Article
            137. Chu BC, Peacock RS, Vogel HJ: Bioinformatic analysis of the TonB protein family. Biometals 2007,20:467–483.PubMedView Article
            138. Finn RD, Tate J, Mistry J, Coggill PC, Sammut JS, Hotz HR, Ceric G, Forslund K, Eddy SR, Sonnhammer EL, Bateman A: The Pfam protein families database. Nucleic Acids Res 2008,36:D281–288.PubMedView ArticlePubMed Central
            139. Mistry J, Finn R: Pfam: a domain-centric method for analyzing proteins and proteomes. Methods Mol Biol 2007,396:43–58.PubMedView Article
            140. Katoh K, Kuma K, Toh H, Miyata T: MAFFT version 5: improvement and accuracy of multiple sequence alignment. Nucleic Acids Res 2005,33:511–518.PubMedView ArticlePubMed Central
            141. Minh BQ, Vinh LS, von Haeseler A, Schmidt HA: pIQPNNI -- Parallel reconstruction of large maximum likelihood phylogenies. Bioinformatics 2005,21:3794–3796.PubMedView Article
            142. Müller T, Vingron M: Modeling amino acid replacement. J Comput Biol 2000,7:761–776.PubMedView Article
            143. Schmidt HA, Strimmer K, Vingron M, von Haeseler A: Tree-Puzzle: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 2002,18:502–504.PubMedView Article
            144. Frickey T, Lupas A: CLANS: a Java application for visualizing protein families based on pairwise similarity. Bioinformatics 2004,20:3702–3704.PubMedView Article
            145. Felsenstein J: PHYLIP - Phylogeny Inference Package (Version 3.2). Cladistics 1989,5:164–166.
            146. Cai YP, Wolk CP: Use of a conditionally lethal gene in Anabaena sp . strain PCC 7120 to select for double recombinants and to entrap insertion sequences. J Bacteriol 1990,172:3138–3145.PubMedPubMed Central
            147. Valladares A, Muro-Pastor AM, Fillat MF, Herrero A, Flores E: Constitutive and nitrogen-regulated promoters of the petH gene encoding ferredoxin:NADP+ reductase in the heterocyst-forming cyanobacterium Anabaena sp . FEBS Lett 1999,449:159–164.PubMedView Article
            148. Kaneko T, Nakamura Y, Wolk CP, Kuritz T, Sasamoto S, Watanabe A, Iriguchi M, Ishikawa A, Kawashima K, Kimura T, Kishida Y, Kohara M, Matsumoto M, Matsuno A, Muraki A, Nakazaki N, Shimpo S, Sugimoto M, Takazawa M, Yamada M, Yasuda M, Tabata S: Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium Anabaena sp . strain PCC 7120. DNA Res 2001,8:205–213. 227–253PubMedView Article

            Copyright

            © Mirus et al. 2009

            This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

            Advertisement