Skip to main content

Table 1 Primer and oligonucleotide pairs used for PCR, cloning and site-directed mutagenesis

From: A novel Rho-dependent pathway that drives interaction of fascin-1 with p-Lin-11/Isl-1/Mec-3 kinase (LIMK) 1/2 to promote fascin-1/actin binding and filopodia stability

Name Direction Sequence
fascin-1S39A/D cDNAs Forward GTACGGATCCATGACCGCCAACGGCACAGCC
Subclonings into pcDNA3.mRFP(N) Reverse GTACGAATTCCTAGTACTCCCAGAGCGAGGC
fascin-1 cDNA Forward CCGGGAAGCTTCGCAGCGGCCTCTCG
Subcloning into pCR-Blunt Reverse GACGGGCCTAGGCTAGTACTCCCAGAG
LIMK1/460A mutagenesis Forward GAACATCATCCACCGAGCCCTCAACTCCCACAAC
  Reverse GTTGTGGGAGTTGAGGGCTCGGTGGATGATGTTC
LIMK1/508A mutagenesis Forward GCAAGAAGCGCTACGCCGTGGTGGGCAAC
  Reverse GTTGCCCACCACGGCGTAGCGCTTCTTGC
LIMK2/451A mutagenesis Forward GTGCATCATCCACCGGGCTCTGAACTCGCACAACTG
  Reverse CAGTTGTGCGAGTTCAGAGCCCGGTGGATGATGCAC
LIMK2/505A mutagenesis Forward CGCAAGAAGCGCTACGCGGTGGTGGGAAACC
  Reverse GGTTTCCCACCACCGCGTAGCGCTTCTTGCG