Skip to main content

Table 1 Primers used in this study

From: Rapid production of antigen-specific monoclonal antibodies from a variety of animals

Name Sequence Application
human IgGV AS1 ACGCTGCTGAGGGAGTAGAGTCCTGAG 5' RACE PCR human VH first
human IgGV AS2 AGCCGGGAAGGTGTGCACGCCGCTG 5' RACE PCR human VH second
human IgKV AS1 CTTTGGCCTCTCTGGGATAGAAGTT 5' RACE PCR human V first
human IgKV AS2 ACAACAGAGGCAGTTCCAGATTTCAACTGC 5' RACE PCR human V second
human IgλV AS1 TCACDGSYCCCGGGTAGAAGTCACT 5' RACE PCR human V first
human IgλV AS2 AGTGTGGCCTTGTTGGCTTG 5' RACE PCR human V second
rat IgGC S AGAGACTCGAGTGGAACTCTGGAGCCCTGTCCAGCG Rat IgG constant gene cloning
rat IgGC AS CTCTCTGCGGCCGCGGGTCATTTACCCGGAGAGTGGGAGAG Rat IgG constant gene cloning
rat IgKC S AGAGACTCGAGGGGCTGATGCTGCACCAACTGTATC Rat IgK constant gene cloning
rat IgKC AS CTCTCTGCGGCCGCGTCTAACACTCATTCCTGTTGAAGCTC Rat IgK constant gene cloning
rat IgGV AS1 GCAGGTGACGGTCTGGCTGGRCCAGGTGCTGGA 5' RACE PCR rat VH first PCR
rat IgGV AS2 CTGCAGGACAGCTGGGAAGGTGTGCAC 5' RACE PCR rat VH second PCR
rat IgKV AS1 TAACTGTTCCGTGGATGGTGGGAAGAT 5' RACE PCR rat V first PCR
rat IgKV AS2 TCGTTCAGTGCCATCAATCTTCCACTTGAC 5' RACE PCR rat V second PCR
rat IgH cassette S TGGAACTCTGGAGCCCTGTCCAGCGGTG Rat IgH cassette amplification
rat IgLk cassette S GGGCTGATGCTGCACCAACTGTATC Rat IgLk cassette amplification
rab IgGC S AGAGAGCTCGAGTGCCTGGTCAAAGGCTACCTCCCG Rabbit IgG constant gene cloning
rab IgGC AS GTGTGTGCGGCCGCGCTCATTTACCCGGAGAGCGGGAGAT Rabbit IgG constant gene cloning
rab IgKC S AGAGAGCTCGAGGATCCAGTTGCACCTACTGTCCTCA Rabbit IgK constant gene cloning
rab IgKC AS AGAGAGGCGGCCGCTCTAGCAGTCACCCCTGTTGAAGCT Rabbit IgK constant gene cloning
rab IgGV AS1 GCTGGCTGCTTGAGGTCACGCTCACCAC 5' RACE PCR rabbit VH first PCR
rab IgGV AS2 CTGCCGGACGGACGGGAAGGTGCGTAC 5' RACE PCR rabbit VH second PCR
rab IgKV AS1 CAGTTGTTTGGGTGGTGCCATCCAC 5' RACE PCR rabbit V first PCR
rab IgKV AS2 GGGTGGTGCCATCCACCTCCCAGGTGAC 5' RACE PCR rabbit V second PCR
rab IgH cassette S CCAGTTGCACCTACTGTCCTCATCTTCC Rabbit IgH cassette amplification
rab IgLk cassette S GATCCAGTTGCACCTWCTGTCCTCMTCTTCC Rabbit IgLk cassette amplification
g-pig IgGC S AGAGACTCGAGTGCCTGGTCAAGGGCTACTTCCCTGA Guinea pig IgG constant gene cloning
g-pig IgGC AS2 ATCTCCCGGTCTCCGGGTAAATGAGCGGCCGCTCTCTC Guinea pig IgG constant gene cloning
g-pig IgKC S AGAGACTCGAGGGGACCAAGCTGGAAATCAAACGGA Guinea pig IgK constant gene cloning
g-pig IgKC AS TATATAGCGGCCGCCTAGCACTCGCTCCTGTTGATGGTCT Guinea pig IgK constant gene cloning
g-pig IgλC S AGAGACTCGAGTGCCTGGTCAAGGGCTACTTCCCTGA Guinea pig Igλ constant gene cloning
g-pig IgλC AS GAGAGAGCGGCCGCTCATTTACCCGGAGACCGGGAGAT Guinea pig Igλ constant gene cloning
g-pig IgGV AS1 CTTGTCCACCTTGGTGCTGCTGGCCGGGTG 5' RACE PCR guinea pig VH first
g-pig IgGV AS2 GACTGAAGGACGGCCGGGAAGGTGTGCAC 5' RACE PCR guinea pig VH second
g-pig IgKV AS1 CAGAGCCATCCACCTTCCACTTGACGG 5' RACE PCR guinea pig V first
g-pig IgKV AS2 GAAGAGGGAGATAGTTGGCTTCTGCACACT 5' RACE PCR guinea pig V second
g-pig IgλV AS1 CTGCTGGCCATGTATTTGTTGTCGCTCTG 5' RACE PCR guinea pig V first
g-pig IgλV AS2 AGAAGGAATTCAGGAGACACACCACTGT 5' RACE PCR guinea pig V second
g-pig IgH cassette S TGCCTGGTCAAGGGCTACTTCCCTGAGC Guinea pig IgH cassette amplification
g-pig IgLk cassette S GGGACCAAGCTGGAAATCAAACGGAG Guinea pig IgLk cassette amplification
g-pig IgLλ cassette S GAGGAGCTCCAGGACAACAAGGCCAC Guinea pig IgLλ cassette amplification
Nhe polyC S GCTAGCGCTACCGGACTCAGATCCCCCCCCCCCCCDN 5' RACE PCR first
Nhe-Eco47 CGCTAGCGCTACCGGACTCAGATCCC 5' RACE PCR second
Cassette AS GGGGGGGGGGGGGATCTGAGTC Cassette amplification
Joint S AGAGAAACCGTCTATCAGGGCGATGGC TS-jPCR
Joint AS AGAGACCCTTTGACGTTGGAGTCCACG TS-jPCR
  1. PCR = polymerase chain reaction; RACE = rapid amplification of cDNA ends; TS-jPCR = target-selective joint PCR.