Skip to main content

Table 1 Primers used in experiments

From: LoxP-FRT Trap (LOFT): a simple and flexible system for conventional and reversible gene targeting

Purpose   Sequence (5' → 3')
Screening ES cells Left arm F CCGCCTACATTCTCCATCTTCTCCA
  Left arm R CAGTCCCTTCCCGCTTCAGTGACAA
  Right arm F TACGTATGGCACATAGAACTTGATA
  Right arm R GAGCACCCAGTCCGCCCTGAGCAAA
RT-PCR Forward CGGGACAAAGGGAAGCGAAG
  Reverse CGCCACATGCCACCAATAATC
Nested PCR for amplicons produced by RT-PCR Forward GGACAAAGGGAAGCGAAGCCGGAGCTG
  Reverse GCCACATGCCACCAATAATCTTGCCAAT
Production of probe for Southern blot Forward CCACTCCCCGTGGAACACGC
  Reverse CCGTGACCCGGCTGTTGGTG
  1. Abbreviations: ES, embryonic stem; RT, reverse transcriptase.