Skip to main content

Table 1 Primer sequences used for reverse transcription-PCR in this study

From: Integration-deficient lentivectors: an effective strategy to purify and differentiate human embryonic stem cell-derived hepatic progenitors

Gene Direction Primer sequence 5′→3′ Annealing temperature, °C Amplicon size, bp
FoxM1B Forward GGGCGCACGGCGGAAGATGAA 55 492
Reverse CCACTCTTCCAAGGGAGGGCTC
Fibrinogen β Forward CAAGGTGTCAACGACAATGAGGAG 55 315
Reverse CAGGTCTGGGTCAGCGTGAAGAGA
HNF4α Forward CTGCTCGGAGCCACCAAGAGATCCATG 55 370
Reverse ATCATCTGCCACGTGATGCTCTGCA
AFP Forward AGAACCTGTCACAAGCTGTG 55 675
Reverse GACAGCAAGCTGAGGATGTC
ApoA-II Forward GGAGAAGGTCAAGAGCCCGAG 55 246
Reverse AGCAAAGAGTGGGTAGGGACAG
FIX Forward GTCCTGTGAACCAGCAGTGCC 56 512
Reverse TTGTCAGCAATGCAAATAGGT
Β-actin Forward TCACCACCACGGCCGAGCG 58 350
  Reverse TCTCCTTCTGCATCCTGTCG