Skip to main content

Table 1 Primers used in the study

From: Genome-scale reconstruction of the sigma factor network in Escherichia coli: topology and functional states

Primer Direction Sequence 5′→3′
Small RNA adaptor - GUUCAGAGUUCUACAGUCCGACGAUC
Small RT primer - CAAGCAGAAGACGGCATACGANNNNNNNNN
Amplification primers Forward AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
  Reverse CAAGCAGAAGACGGCATACGA
  1. RT, reverse transcription.