Skip to main content

Table 2 Primer sequences for ribonuclease protection assay probes and quantitative PCR

From: Expression of PEG11 and PEG11AS transcripts in normal and callipyge sheep

    Sizea Tm Locationb
Primer Sequence bp °C  
PEG11/PEG11AS    
C F AGGAACACCGCTGTGGAGGTAGAA 135 59 4337
  R ACAGCAGAGGCAGCCAAGCA    
E F GGTGACGCCCGTCTGCAAGT 180 61 2427
  R GTGGAACGGTTCGCCGACAT    
Pc F ACAGCTCAACAGTGGAGGTCATG 199 55 996
  R ATCAGCTGGCAGAGCACGATGAAC    
F F TTCCCCCATGGCTGTGAGAAAT 175 58 -390
  R CCTCTGTGACCTTCTGGTGACCAA    
G F AGGCTGAATTGACAGAGATGT 124 49 -1193
  R GTTAAATGGCTCAAGAACGA    
DLK1 F CCCGTCCTCTTGCTCCTGCT 116 58  
  R GGCTGGCACCTGCACACACT    
MEG8 F CCCAGGGAGTGTGAGGCTCTTCT 100 56  
  R GGACCCACGGCTGACCTGTT    
G3PD F TGAGTGTCGCTGTTGAAGT 150 58  
  R CCTGCCAAGTATGATGAGAT    
  1. aSize of the PCR product and protected fragment for RPA bLocation for the PCR product is relative to the first base of the PEG11 open reading frame. cCharlier et al. [3]
\