Skip to main content

Table 7 SDR units in Oltmannsiellopsis cpDNA

From: The complete chloroplast DNA sequence of the green alga Oltmannsiellopsis viridis reveals a distinctive quadripartite architecture in the chloroplast genome of early diverging ulvophytes

    Numbera
Designation Size (bp) Sequence 100% 90%
A 11 CAACACTYCCA 252 426
B 11 AWAGCGAAGCW 89 126
C 7 GCCCCCC 126 126
D 8 GGGGAGGG 45 45
E 21 AGGGGCTTTGCTTCGCGGTTT 17 17
  1. a Numbers of SDR units were determined in searches performed using 100% or 90% sequence identity. The genomic locations of these repeated elements are reported in [GenBank: DQ291132].