Skip to main content

Table 2 Primers used for the quantitative real-time PCR.

From: Arthritis suppression by NADPH activation operates through an interferon-β pathway

UniGene Gene name FP/RP Sequence (5'-3')
Rn.1079 Arbp FP AGAGTCGGAGGAATCCGATGA
   RP AAGCAGGCTGACTTGGTGTGA
Rn.38575 Ncf1 FP CGAGAGTGGCTGGTGGTT
   RP CATACGGTTCACCTGCGTAGT
Rn.5078 Ass FP TGTTCGCCACTGCATCGA
   RP TGGCCCTTGAAGACAGATACCT
Rn.7391 Cxcl9 FP ACGGAGATCAAACCTGCCTAGAC
   RP CATCAGCTTCTTCACCCTTGCT
Rn.33193 Mmp12 FP AGGTACGATGTGAGGCAGGAA
   RP TCCTGGGAAGTGTGTAGAAATCAG
Rn.14882 Best5 FP TCATTCTGCGTTGGAGTTTGG
   RP CTGAATTATTGATGGGAGGAGTCA
Rn.101159 IRF7 FP CAGAACCCCAACTTCCAATAGAGT
   RP TAGAGATGACATATAGCCAAGGAATAAGC
Rn.35775 Ifit3 FP TGGGAGGCAACACGATTTG
   RP TGACACACTTCCGGTTGTTATCAG
Rn.10383 Oas1 FP GGATCACAGTCCATGCTTCTGA
   RP CTGTGATTGGACAGTATTCAAACATG
Rn.10374 Mx2 FP GTGACACCAGTGAGAAGAGGAGATT
   RP GCTAGCCTGCGCTGAGCTT
Rn.6703 S100a9 FP TGGACACAAACCAGGACAATCA
   RP CTCATGACAGGCAAAGATCAACTT
Rn.143194 Ifnα 1 FP GCAACCCTCCTAGACTCATTCTG
   RP ACCCCTACCTGCTGCATCAG
Rn.138105 Ifnβ 1 FP CTTGGGTGACATCCACGACTAC
   RP GGCATAGCTGTTGTACTTCTTGTCTT
Rn.10795 Ifnγ FP AATCGCACCTGATCACTAACTTCTT
   RP TGGGTTGTTCACCTCGAACTT
  1. The final concentration of each primer in the sample was 400 nM, except for Ifnβ 1, for which 800 nM was used.
  2. FP, forward primer; RP, reverse primer.