Organism | No. of protein-coding genes | Genes with introns (%) | No. of rRNA gene units | No. of chromosomes with histone genes | Transposable elements in genome (%) | Telomere repeat sequences |
---|---|---|---|---|---|---|
Arabidopsis | 26207 | 79 | ~800 | 5≤ | ~15 | TTTAGGG |
Ostreococcus | 8166 | 39 | 4 | 6≤ | ~10 | TTTAGGG |
Cyanidioschyzon | 4775 | 0.5 | 3 | 1 | 0.7 | AATGGGGGG |
Ashbya | 4718 | 5 | ~50 | 4≤ | 0.1> | CGCTGAGAGACCCATACACCACAC |