Skip to main content

Table 2 Comparison of the nuclear genomes of Cyanidioschyzon, Ostreococcus (an ultra-small green alga), Arabidopsis (a flowering plant) and Ashbya (a filamentous fungal pathogen).

From: A 100%-complete sequence reveals unusually simple genomic features in the hot-spring red alga Cyanidioschyzon merolae

Organism No. of protein-coding genes Genes with introns (%) No. of rRNA gene units No. of chromosomes with histone genes Transposable elements in genome (%) Telomere repeat sequences
Arabidopsis 26207 79 ~800 5≤ ~15 TTTAGGG
Ostreococcus 8166 39 4 6≤ ~10 TTTAGGG
Cyanidioschyzon 4775 0.5 3 1 0.7 AATGGGGGG
Ashbya 4718 5 ~50 4≤ 0.1> CGCTGAGAGACCCATACACCACAC
  1. Bold type indicates the smallest number in non-symbiotic eukaryotes.
  2. Two non-symbiotic eukaryotes, Schizosaccharomyces pombe and the filamentous fungus Ashbya gossypii, have nuclear protein-coding genes that are as small in number as those of C. merolae.
  3. The number of protein-coding genes in the nuclear genome of S. pombe [6] increased to 5004 http://www.sanger.ac.uk/Projects/S_pombe/genome_stats.shtml.
  4. Although A. gossypii was reported to contain 4718 protein-coding nuclear genes [13], the genome project of this fungus is now in progress http://agd.unibas.ch/; thus it possibly contains more than 4775 protein-coding genes.
\