Skip to main content

Advertisement

Table 4 Oligonucleotide primers used in the N. gonorrhoeae MLST scheme

From: Species status of Neisseria gonorrhoeae: evolutionary and epidemiological inferences from multilocus sequence typing

Locus Name Sequence (5'-3') Function
abcZ abcZ-P1 AATCGTTTATGTACCGCAGG Amplification and sequencing
abcZ abcZ-S2 GAGAACGAGCCGGGATAGGA Amplification and sequencing
adk adk-P1 ATGGCAGTTTGTGCAGTTGG Amplification
adk adk-P2 GATTTAAACAGCGATTGCCC Amplification
adk adk-S1 AGGCTGGCACGCCCTTGG Sequencing
adk adk-S2 CAATACTTCGGCTTTCACGG Sequencing
aroE aroE-P1 ACGCATTTGCGCCGACATC Amplification and sequencing
aroE aroE-P2 ATCAGGGCTTTTTTCAGGTT Amplification
aroE aroE-S2 ATGATGTTGCCGTACACATA Sequencing
fumC fumC-P1 CACCGAACACGACACGATGG Amplification
fumC fumC-P2 ACGACCAGTTCGTCAAACTC Amplification
fumC fumC-S1 TCCGGCTTGCCGTTTGTCAG Sequencing
fumC fumC-S2 TTGTAGGCGGTTTTGGCGAC Sequencing
gdh gdh-P1 ATCAATACCGATGTGGCGCGT Amplification
gdh gdh-P2 GGTTTTCATCTGCGTATAGAG Amplification and sequencing
gdh gdh-S3 CCTTGGCAAAGAAAGCCTGC Sequencing
pdhC pdhC-P1 GGTTTCCAACGTATCGGCGAC Amplification
pdhC pdhC-P2 ATCGGCTTTGATGCCGTATTT Amplification and sequencing
pdhC pdhC-S1 TCTACTACATCACCCTGATG Sequencing
pgm pgm-S1 CGGCGATGCCGACCGCTTGG Amplification and sequencing
pgm pgm-S2 GGTGATGATTTCGGTTGCGCC Amplification and sequencing
  1. Oligonucleotide primers were as previously published [16,25].