Skip to main content

Table 2 Microsatellite loci used in the study. Name, GenBank accession numbers, repeat motif and primer sequences (F: forward, R: reverse primer) are given for the three newly developed microsatellite loci for L. neglectus. For other loci see Fjerdingstad et al [58]. The product size in basepairs (bp) and the optimal annealing temperature in degrees Celsius (°C) are shown for L. neglectus. N, number of studied populations of L. neglectus; n, number of individuals; k, observed number of alleles; H o, observed heterozygosity; H e, expected heterozygosity assuming no genetic differentiation among populations.

From: The introduction history of invasive garden ants in Europe: Integrating genetic, chemical and behavioural approaches

Locus Accession number Repeat motif Primer sequence (5'-3') Product size (bp) Annealing temperature (°C) N n k H o H e
Lng-1 [GenBank:EU057967] (CA)5T (AC)2AA (CA)13 F: TCTCGCTCCAACTACTTAAA
R: TTGTCTTCAAATTGTCCAAC
204–220 55 14 417 6 0.37 0.64
Lng-3 [GenBank:EU057968] (CA)14 F: GATGCCAAGTTTACATGG
R: CACAATACTCACATATTCACAA
112–132 55 14 417 6 0.06 0.11
Lng-4 [GenBank:EU057969] (CA)11 F: GTGAACGAATATATCATGGAT
R: CGTTGACGAAAATAGCTC
159–167 55 14 415 4 0.06 0.11
L1–5 -- -- -- 285–301 55 14 402 9 0.56 0.81
L10–174 -- -- -- 234–298 62 14 416 20 0.42 0.88
L10–282 -- -- -- 256–258 55 14 414 2 0.02 0.02