Skip to main content

Table 3 GenBank accessions and primers used for the cloning of the various plant cDNAs

From: A subgroup of plant aquaporins facilitate the bi-directional diffusion of As(OH)3 and Sb(OH)3across membranes

Name used in this work GenBank accession number to protein sequence GenBank accession number to nucleotide sequence Forward and reverse primer for the cloning of the genes
AtNIP1;1 CAA16760 Y07625 Forward 5' ATGGCGGATATCTCGGGAAAC 3'
Reverse 5' TCAAGTGCTACCGATTCTCACG 3'
Atnip1;1Δ 2–44    Forward 5' ATGTCTCTACTCTCAGTCTCTGTCCCT 3'
Reverse 5' TCAAGTGCTACCGATTCTCACG 3'
AtNIP2;1 T02327 AJ276475 Forward 5' ATGGATGACATATCAGTGAGCA 3'
Reverse 5' TCACAGAGGAAGATCGGTAAC 3'
Atnip2;1Δ 2–37    Forward 5' ATGTCCCCTCCTTTGCTC 3'
Reverse 5' TCACAGAGGAAGATCGGTAAC 3'
AtNIP5;1 T04053 AY087560 Forward 5' ATGGCTCCACCGGAGGCTGA 3'
Reverse 5' TTAACGACGAAAGCTCCTAACCGG 3'
Atnip5;1Δ 2–67    Forward 5' ATGGATTTTCCCTCTCCTGATGTCTC 3'
Reverse 5' TTAACGACGAAAGCTCCTAACCGG 3'
AtNIP6;1 AAF14664 BT020229 Forward 5' ATGGATCATGAGGAAATTC 3'
Reverse 5' TCATCTTCTGAAGCTCCTC 3'
Atnip6;1Δ 2–29    Forward 5' ATGGGGAAGAGGAATGGACAC3'
Reverse 5' TCATCTTCTGAAGCTCCTC 3'
Atnip6;1Δ 2–69    Forward 5' ATGTCTCTCCCTCCCCCTAA 3'
Reverse 5' TCATCTTCTGAAGCTCCTC 3'
AtNIP7;1 AAF30303 AY087797 Forward 5' ATGAATGGTGAGGCACGGTCA 3'
Reverse 5' TTAACGTAAAAGTGAAGAAACGGAAGG 3'
Atnip7;1Δ 2–35    Forward 5' ATGCTCCCCTATGATATAGATCTCAATC 3'
Reverse 5' TTAACGTAAAAGTGAAGAAACGGAAGG 3'
LjNIP5;1 EU294214 ABY19373 Forward 5' ATGCCTCCGCTGTGGAAGAA 3'
Reverse 5' CTAGCGACGGAAGCTCCTAACC 3'
Ljnip5;1Δ 2–59    Forward 5' ATGGATTTCTCTGCTGGTATTGG 3'
Reverse 5' CTAGCGACGGAAGCTCCTAACC 3'
LjNIP6;1 EU294215 ABY19374 Forward 5' ATGGACAACAATGAGGACATTCC 3'
Reverse 5' TCACCTTCTGAAGCTGGGGT 3'
Ljnip6;1Δ 2–72    Forward 5' ATGTCATTGCCATCCCCTCCT 3'
Reverse 5' TCACCTTCTGAAGCTGGGGT 3'
OsNIP1;1 Q40746 D17443 Forward 5'GGCTTAAUATGGCAGGAGGTGACAACAA3'
Reverse 5'GGTTTAAUTTAGGTGGAGGAGTTCATCCG 3'
OsNIP2;1 Q6Z2T3 AB222272 Forward 5'GGCTTAAUATGGCGAGCAACAACTCCAGA 3'
Reverse 5'GGTTTAAUTCACACTTGAATGTTCTCCATCTCG 3'
OsNIP2;2 Q67WJ8 AP003569 Forward 5'GGCTTAAUATGGCATCGACGACAGCG 3'
Reverse 5'GGTTTAAUTTATACGTTGTCGAACTCGTCGG 3'
OsNIP3;2 Q7EYH7 AP004461 Forward 5'GGCTTAAUATGGAAGGGGGCAAGATG 3'
Reverse 5'GGTTTAAUCTACAGCTTGATTGCAAAATAAAAC3'
At1g02260 AAY56454 BT023463 Forward 5'GGCTTAAUATGGCAATGGCTCCTGTAA 3'
Reverse 5'GGTTTAAUTTACTTGATAAGGAAGAGACCAATC3'
OsLsi2 NP_001048691 NM_001055226 Forward 5'GGCTTAAUATGAGTGAGCTTGCGTCGG 3'
Reverse 5'GGTTTAAUTCAGATCTTGCCGATGAGGG 3'
Os10g0547500 NP_001065297 NM_001071829 Forward 5'GGCTTAAUATGGCACTGGCGTCGCTG 3'
Reverse 5'GGTTTAAUCTAGATGTTGATCTTGCCGATGAGA 3'