Skip to main content

Table 2 PCR primers used for amplification of the α- and β-like globin genes including GBY from the platypus gDNA and cDNA

From: Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

Gene Forward Primer Reverse Primer gDNA
(bp)
cDNA
(bp)
ζ GGCCGACAAGACCGCAGTCATCTCCC CCCGATGGCGCTGATGACT 527 190
ζ 1 TGACCAAAGGCGACAAGACCT CCCCGATGGCACCGATGACC 534 198
α D GAGGCTGTGAAGAACCTGGA GGTGTACTCCCCTTGCAGAT 1793 153
α 2 TGGCCCACCTCGATGACCTGG GGGAAGGTGTCTGGCCACC 289 134
α 1/α 3 GCAAGGCCGCCGGTCACGGC CGCTGTCCATGTCATCGAAGTGCC 597 192
ω ATTGTGTCCATCTGGGGAAA GCTTGGCAAAGTTGCTCTTC 488 232
GBY CTGGAAACAGGTGTGCAAGA CTATCTCCGGGGTGTAGCAG 3202 149
ε ATCTGAGCGCTGAGGAGAAG GACAGGTTGCCGAAGGAGTCA 285 142
β CTGTGGGGGAAAGTGAACAT GGTCAGCACCTTAGCACCAT 321 168