Skip to main content

Table 1 Genes and PCR primers used in viridans group MLSA scheme

From: Assigning strains to bacterial species via the internet

Primer Gene product Sequence (5'-3')* Primer length (bp) Trimmed fragment size (bp) Annealing temperature (°C)
guaA-up GMP synthase ATYCARTTYCACCCMGAAGT 20 567 55
guaA-dn   CWGGNCCWGGRAATGGTTG 19   55
map-up Methionine aminopeptidase GCWGACTCWTGTTGGGCWTATGC 23 348 55
map-dn   TTARTAAGTTCYTTCTTCDCCTTG 24   55
pfl-up Pyruvate formate lyase AACGTTGCTTACTCTAAACAAACTGG 26 351 55
pfl-dn   ACTTCRTGGAAGACACGTTGWGTC 24   55
ppaC-up Inorganic pyrophosphatase GACCAYAATGAATTYCARCAATC 23 552 50
ppaC-dn   TGAGGNACMACTTGTTTSTTACG 23   50
pyk-up Pyruvate kinase GCGGTWGAAWTCCGTGGTG 19 492 50
pyk-dn   GCAAGWGCTGGGAAAGGAAT 20   50
rpoB-up RNA polymerase beta subunit AARYTIGGMCCTGAAGAAAT 20 516 50
rpoB-dn   TGIARTTTRTCATCAACCATGTG 23   50
sodA-up Superoxide dismutase TRCAYCATGAYAARCACCAT 20 378 50
sodA-dn   ARRTARTAMGCRTGYTCCCARACRTC 26   50
tuf-up Elongation factor Tu GTTGAAATGGAAATCCGTGACC 22 426 55
tuf-dn   GTTGAAGAATGGAGTGTGACG 21   55
  1. *Sequences are shown using the IUPAC codes for sites where degeneracy was introduced.