Skip to main content

Table 1 Primers used in the study.

From: Genetic determinants of mate recognition in Brachionus manjavacas(Rotifera)

Gene GenBank Accession Number Primer Primer sequence (5'-3')
MMR-A4 GQ374516 MMRA4F ATGAAATCAATTTTATGTTCCTSCTG
   MMRA4R TTAATCARAATAAAGAGGAAAAG
MMR-A7 GQ374517 MMRA7F ATGAAATCAATTTTATGTATCCTSCTG
   MMRA7R GTATTTTTTATTTTTGATAAAAATCTG
MMR-B3 GQ374518 MMRBF GTACCAGTYAAGCAAATAGCTGAACC
   MMRBR ATATTTTAAATTTAACCTTGAACC
MMR-B5 NA MMRBF GTACCAGTYAAGCAAATAGCTGAACC
   MMRBR ATATTTTAAATTTAACCTTGAACC
MMR for RNAi (vector-specific) NA RNAiF ACCATGATTACGCCAAGCTCAG
   RNAiR GTTTTCCCAGTCACGACGTTG
MMR (vector-specific for double-stranded RNA synthesis) NA RNAi-T7F TAATACGACTCACTATAGGACCATGATTACGCCAAGCTCAG
   RNAi-T7R TAATACGACTCACTATAGGGTTTTCCCAGTCACGACGTTG
GDP-mannose 4,6-dehydratase (MAN) FJ829249 MANF
MANR
GGGGTATGTTTTGTCCCAATC
ACCCAGCAGCATATGGTTTC
   MANF-T7F
MANR-T7R
TAATACGACTCACTATAGGGGGGTATGTTTTGTCCCAATC
TAATACGACTCACTATAGGACCCAGCAGCATATGGTTTC
  1. NA = not applicable.