Skip to main content

Table 2 Oligonucleotide sequences of primers utilized for chromatin immunoprecipitation experiments.

From: Retinoic acid enhances skeletal muscle progenitor formation and bypasses inhibition by bone morphogenetic protein 4 but not dominant negative β-catenin

Target Gene Target Sequence and Position Forward primer Reverse primer
Meox1-1 AGTTCAAGCCTCA (-45995) CATGAGTTCAAGCCTCAGCA CCAGAGATACGCTTGGTGTC
Meox1-2 AGGTCACAGGGTCA(-33869) GAGGCCTAGCTTCAGCTCCT TGAAATGCCTGATCTGACACA
Wnt3a-1 TGAACTCATGACCC(-10844) GAGGGAATCAAATCCCATTATAGA GGCAGAACCTGTAGTCAGAAACT
Wnt3a-2 TGACCTTTTGACCT(-20576) CAGGTATTGCCATCCAGGTT GAGAATGCTCTGTGGGGTTC
Pax3-1 AGGTCAGGCTGGCTTCA(-97389) ACAGGGTAAAACAATGTGTGGA TTGAAGCCAGCCTGACCTAT
Pax3-2 AGTTCAAGGGTCA(+114735) AGTGGAGCGCACCTCTGT CTACAAACCCTTAATGACAAACG
RARβ2 GGTTCACCGAAAGTTCA(-319) GGTTCACCGAAAGTTCACTCGCAT CAGGCTCGCTCGGCCGATCCA