Skip to main content

Table 3 Primers used for reverse transcription polymerase chain reaction analysis and sequence confirmation.

From: TonB-dependent transporters and their occurrence in cyanobacteria

Use Primer Oligonucleotide sequence
RT-PCR all1101-F CGCTGCTCTATCGCCTGACTG
  all1101-R GCGTACTTTCCAGCGATTGTGC
  all2148-F ACGGTGACGGGGGAAACAGGA
  all2148-R ACTTCCACTCGCTCAATCGTCC
  all2158-F CACCACCAGCAGAACCAACAGC
  all2158-R CGATAAATCCACCTCACCACGG
  all2236-F AATCGCGCGGCACTCTACCGT
  all2236-R GGATAACTCCAATCCCACGAGC
  all2610-F CAGTCATAGGAGAGGCGGGATT
  all2610-R CATAGAGTACAGAAGCCGGTCC
  all2620-F AAACTCCCTCAACCGCGCTGG
  all2620-R GGAATCCGCGAACCATCGGC
  all2674-F CCCAGAAACACCTACCGCAGAA
  all2674-R AACTAGGTTGACGACCCCACCT
  all3310-F TTTAGGCAACCCAGGCGGCAC
  all3310-R GCATTATGCTCAAAGGTGACGCG
  all4026-F GTGGTTTTTGTGGAGTGTGGGG
  all4026-R CCATCAACTGGTGTGTCTTCCC
  all4924-F CCCTACCAGAGGATCTGGGGA
  all4924-R CTGTACCAACGGCTGGTAAGAC
  alr0397-F TGCGTCGCGGGATTTGCGAAC
  alr0397-R GGATAGTATTGACCCTGGGGTC
  alr2153-F CCTCCCGTGGGATTAACTTTGG
  alr2153-R CGCATCAGGGCCCACTCGA
  alr2175-F GGTGTCCCGGCTGTTGGTACT
  alr2175-R AGTACCTCAAACCTCTCTGGGC
  alr2185-F CCCCGTCAGGTACTCGAAGAC
  alr2185-R TCTTCCATGTCAAGCTAGGGGC
  alr2209-F CCTACTCCCACACCCCCAAC
  alr2209-R CTGTCTTGGTCAGGTCTTCGGG
  alr2211-F CAAGATCGCCAAGTGGTGAGGC
  alr2211-R GTGTTTCCAGGTAACAAGCCCC
  alr2581-F GCGGGGACAGAAGGCAAATTTG
  alr2581-R CGCCTAATTGTTCTGTACCCCC
  alr2588-F CAGGTGAGGCGGGATTACCTG
  alr2588-R ACTCCCCCTGGTTCTAGTTGTC
  alr2592-F CCCCAAAGCCAGTGGAGGGA
  alr2592-R CCCCTAGCGGCTCGAACATTG
  alr2596-F CGCCTGTGCGCGATATTCCTG
  alr2596-R CAGGCGCAACAAATACCCGTTC
  alr2626-F GGCGTTCAACCAGGGGGAGT
  alr2626-R CTAAACCAGGTCTGGGTATGGC
  alr3242-F CCCGACGTGATAGTGGGTCAC
  alr3242-R CTGGGGGAATCCGGCTGCAT
  rnpB-F AGGGAGAGAGTAGG GTTGG
  rnpB-R GGTTTACCGAGCCAGTACCTCT
Sequence confirmation all2619-20 F CTCCCATTTCTCCGAAGCTG
  all2619-20 R CAACGCTGGGGCCAACATAG
  alr4028-29 F CTATGGACTTAACCAACAAAGCATTC
  alr4028-29 R CTTCTCTGGTTTAAGGTCAGGATTAC