Skip to main content

Table 4 Primers

From: A large new subset of TRIM genes highly diversified by duplication and positive selection in teleost fish

Rainbow trout Primer sequences
Q PCR  
OmOLIB144F AGGACATGAGGGCTTTCTGCTT
OmOLIB144R GGACCAGGACCAGTTCTGTTGT
IFNGF GCTGTTCAACGGAAAACCTGTTT
IFNGR TCACTGTCCTCAAACGTG
3'RACE  
omOLIB32ALL GTGAACAACCGTCCAAATGGCTCA
Zebrafish  
3'RACE  
zftrall1S TGTGGACACAGTTACTGTATGAGCTG
zftrall2S TGCAGACAGACCTTCACTCCAAGACC