Skip to main content

Table 2 The primers used in this study.

From: Evidence that a West-East admixed population lived in the Tarim Basin as early as the early Bronze Age

Haplogroup/AMG Primer SNP Length
HVRI-AB L16017 5'-TTCTCTGTTCTTTCATGGGGA
H16251 5'-GGAGTTGCAGTTGATGTGTGA
Sequencing 235 bp
HVRI-CD L16201 5'-CAAGCAAGTACAGCAATCAAC
H16409 5'-AGGATGGTGGTCAAGGGA
Sequencing 209 bp
M 10400T 5'-taattaTACAAAAAGGATTAGACTGtgCT
10400C 5'-TACAAAAAGGATTAGACaGAACC
10400R 5'-GAAGTGAGATGGTAAATGCTAG
10400T 149 bp/142 bp
R L12604 5'-ATCCCTGTAGCATTGTTCG
H12754 5'-GTTGGAATAGGTTGTTAGCG
12705C 151 bp
UK L12247 5'-TAACAACATGGCTTTCTCAACT
H12377 5'-GAAGTCAGGGTTAGGGTGGT
12308G 132 bp
C L14318T 5'-CCTTCATAAATTATTCAGCTTCCaACACTAT
L14318C 5'-aaaaagctaCATAAATTATTCAGCTTCCTACtCTAC
H14318R 5'-TTAGTGGGGTTAGCGATGGA
14318C 110 bp/115 bp
C4 L11845 5'- AAGCCTCGCTAACCTCGCC
H12120 5'- GGGTGAGTGAGCCCCATTG
11969A 176 bp
B L8215 5' ACAGTTTCATGCCCATCGTC '
H8297 5' ATGCTAAGTTAGCTTTACAG
CoII/tRNAlys
9-bp deletion
121 bp/112 bp
R1 L4812 5'- GTCCCAGAGGTTACCCAAG
H4975 5'- CCACCTCAACTGCCTGCTA
4917G 164 bp
R11 L9920 5'- CGCCTGATACTGGCATTTTGT
H101075' -GTAGTAAGGCTAGGAGGGTGTTG
10031C 188 bp
HV L14668 5'- CATCATTATTCTCGCACGG
H14831 5'- CGGAGATGTTGGATGGGGT
14766T 164 bp
F 3970T 5' taaaaTGTATTCGGCTATGAAGAtTAA
3970C 5' GTGTATTCGGCTATGAAGtATAG
3970R 5' AGTCTCAGGCTTCAACATCG
3970T 70 bp/66 bp
H L6966 5'-GGCATTGTATTAGCAAACTCAT
H7118 5'-TAGGGTGTAGCCTGAGAATAG
7028C 152 bp
AMG AMG1 5'-CCTGGGCTCTGTAAAGAATAG
AMG2 5'-CAGAGCTTAAACTGGGAAGCTG
  115 bp/121 bp
Paternal hg F Forward 5' CCACAGAAGGATGCTGCTCA
Reverse r 5' CACACTTTGGGTCCAGGATCAC
M89T 125 bp
Paternal hg K Forward 5' GGACCCTGAAATACAGAAC
Reverse 5' AAGCGCTACCTTACTTACAT
M9G 128 bp
Paternal hg P Forward 5' GGGTGTGGACTTTACGAAC
Reverse 5' AAATCCTACTATCTCCTGGC
M45A 129 bp
Paternal hg R1 Forward 5' TTACTGTAACTTCCTAGAAAATTGG
Reverse 5' ATCCTGAAAACAAAACACTGG
M173C 126 bp
Paternal hg R1a1a Forward 5' CTCTTTAAGCCATTCCAGTCA
Reverse 5' AAACATTACATGAGAAATTGCTG
M198A 113 bp