Skip to main content

Table 1 Primer sequences

From: PPARα is essential for retinal lipid metabolism and neuronal survival

Gene Forward 5′ – 3′ Reverse 5′ – 3′
β-Actin CGGTTCCGATGCCCTGAGGCTCTT CGTCACACTTCATGATGGAATTGA
Cpt1a TGGCATCATCACTGGTGTGTT GTCTAGGGTCCGATTGATCTTTG
Fabp3 GTGACAGCAGATGACCGGAA TGCCATGAGTGAGAGTCAGGA
Slc25a20 CTATGTTCGCCGTGTGCTTC GAAGCCTGAATCTGCAGTAAGC
Acaa2 GAACACCCTTTGGAGCTTACG CACATGCCTCGCCAGGTATG
Acadl GCTTGGCATCAACATCGCAG ATTCGCAATATAGGGCATGACAA
Acadm AGTACCCGTTCCCTCTCATCA TACACCCATACGCCAACTCTT
Acads ACAGTGGATCACCCCTTTCAC ACTGAGGGCAAAACAGCCG
Acadvl GGAGGACGACACTTTGCAGG AGCGAGCATACTGGGTATTAGA
Acot13 TAGAGTTTTGGAAAAGGTGACGC GGTTGCTGTCAAGCCTCCAT
Acox1 TAACTTCCTCACTCGAAGCCA AGTTCCATGACCCATCTCTGTC
Acsl1 CCATCTTCCCTGTGGTTCCC ACCCAGGCTCGACTGTATCT
Hadha GGCCTTGTGGAAAAGCTGAC GATAACCAGCGTCACTGCCT
Hmgcs2 GAAGAGAGCGATGCAGGAAAC GTCCACATATTGGGCTGGAAA
Hsd17b4 GTTGCCGGTTTTGAGAAGCC TCCTGGATACACTGGTTTGGC
Gsta3 AGGAACAAACCAGGAACCGT GCTTCTCAGCGCTTTCAGGA
Msra GTAACAGCCAAACACCATGTCA GACCCAGAACTTGCGCTCAG
Prdx5 CCGATCAAGGTGGGAGATGC CTTGGCCTTCAGAGCTCCAG
Prdx6 TTTCCTGGGAGATTCCTGCTGAG TGCCACTTCATCTGCTTATTTAGTT
Pparα GGTGCATTTGGGCGTAACTC AGTCTTGGCTCGCCTCTAAG