Skip to main content

Table 1 Sequences of non-human sRNAs found in plasma preparations, synthetic sRNA templates, primers and annealing temperatures

From: Small RNA profiling of low biomass samples: identification and removal of contaminants

Name RNA sequence Average counts per million in 10 plasma samples Potential origin of sequence Primer sequence Annealing temperature
sRNA 1 (CU)AACAGACCGAGGACUUGAA(U) 133,700 algae AACAGACCGAGGACTTGAA 57 °C
sRNA 2 ACGGACAAGAAUAGGCUUCGGCU 8000 fungi or plants ACGGACAAGAATAGGCTTC 54 °C
sRNA 3 GCCUUGGUUGUAGGAUCUGU 8200 plants GCCTTGGTTGTAGGATCTGT 57 °C
sRNA 4 GCCAGCAUCAGUUCGGUGUG 6800 bacteria CAGCATCAGTTCGGTGTG 57 °C
sRNA 5 GAGAGUAGGACGUUGCCAGGUU 3900 bacteria AGTAGGACGTTGCCAGGTT 57 °C
sRNA 6 UUGAAGGGUCGUUCGAGACCAGGACGUUGAUAGGCUGGGUG 3400 bacteria GAAGGGTCGTTCGAGACC 57 °C
hsa-miR486-5p UCCUGUACUGAGCUGCCCCGAG   human –* 60 °C
  1. * hsa-miR486-5p specific assay from Quanta BIOSCIENCES