Skip to main content

Table 1 Sequences of primers used for qPCR

From: PHOSPHO1 is a skeletal regulator of insulin resistance and obesity

Species Transcript Primer sequences 5′ to 3′
M. musculus Adamts4 F: ATGGCCTCAATCCATCCCAG
R: GCAAGCAGGGTTGGAATCTTTG
M. musculus Adipoq F: GGCCGTTCTCTTCACCTACG
R: TGGAGGAGCACAGAGCCAG
M. musculus Adrb3 Primer Design, Southampton, UK; sequence not disclosed
M. musculus Atgl Primer Design, Southampton, UK; sequence not disclosed
M. musculus Atp5b Primer Design, Southampton, UK; sequence not disclosed
M. musculus Bmp4 F: ATTCCTGGTAACCGAATGCTG
R: CCGGTCTCAGGTATCAAACTAGC
M. musculus Cd68 F: CCATCCTTCACGATGACACCT
R: GGCAGGGTTATGAGTGACAGTT
M. musculus Cfp F: CTGCTACTGGTTATCCTGCCA
R: TCTACCCTGATGTCTCTCCCA
M. musculus Cpt1a Primer Design, Southampton, UK; sequence not disclosed
M. musculus Cxcl14 Primer Design, Southampton, UK; sequence not disclosed
M. musculus Dgat1 Primer Design, Southampton, UK; sequence not disclosed
M. musculus Dgat2 Primer Design, Southampton, UK; sequence not disclosed
M. musculus Esp Primer Design, Southampton, UK; sequence not disclosed
M. musculus Fmod Primer Design, Southampton, UK; sequence not disclosed
M. musculus Fndc5 Primer Design, Southampton, UK; sequence not disclosed
M. musculus Igf1 Primer Design, Southampton, UK; sequence not disclosed
M. musculus Lep F: ATTTCACACACGCAGTCGGTAT
R: GGTGGAGCCCAGGAATGAAG
M. musculus Lpl F: TCTGTACGGCACAGTGG
R: CCTCTCGATGACGAAGC
M. musculus Lum F: CTCTTGCCTTGGCATTAGTCG
R: GGTCATCACAGTACATGGCAGT
M. musculus Mpeg1 F: CTGGATGATAATAGCGTGTGCT
R: AAGACAGGTAGTTTCAGGGCA
M. musculus Pck1 F: CATATGCTGATCCTGGGCATAAC
R: CAAACTTCATCCAGGCAATGTC
M. musculus Phospho1 F: TTCTCATTTCGGATGCCAACA
R: TGAGGATGCGGCGGAATAA
M. musculus Ppara F: CCCTGAACATCGAGTGTCGA
R: AATAGTTCGCCGAAAGAAGCC
M. musculus Ppargc1a F: CCCTGCCATTGTTAAGACC
R: TGCTGCTGTTCCTGTTTTC
M. musculus Prkaa1 Primer Design, Southampton, UK; sequence not disclosed
M. musculus Prkaa2 F: GTCAAAGCCGACCCAATGATA
R: CGTACACGCAAATAATAGGGGTT
M. musculus Slc1a3 F: ACCAAAAGCAACGGAGAAGAG
R: GGCATTCCGAAACAGGTAACTC
M. musculus Slc2a1 F: TCAACACGGCCTTCACTG
R: CACGATGCTCAGATAGGACATC
M. musculus Slc2a10 F: ACCAAAGGACAGTCTTTAGCTG
R: ATCTTCCAAGCAGACGGATG
M. musculus Slc2a12 F: GGGTGTCAACCTTCTCATCTC
R: CCAAAGAGCATCCCTTAGTCTC
M. musculus Slc2a2 F: TGTGCTGCTGGATAAATTCGCCTG
R: AACCATGAACCAAGGGATTGGACC
M. musculus Slc2a4 F: CCAGTATGTTGCGGATGCTAT
R: TTTTAGGAAGGTGAAGATGAAGAAG
M. musculus Ucp1 F: GGATGGTGAACCCGACAACT
R: AACTCCGGCTGAGAAGATCTTG
M. musculus Vdr F: GAATGTGCCTCGGATCTGTGG
R: ATGCGGCAATCTCCATTGAAG