Fig. 5

Independent experimentation validates the presence of rRFs in LCLs. a Boxplots show the abundance of the 5.8S 24-mer i-rRF (GGGCUACGCCUGUCUGAGCGUCGC) across the five LCL populations (434 total samples). Males are represented by gray boxes, and females are represented by orange boxes. The abundance is shown in the boxplots where there is a statistically significant difference between each population according to Welch’s t-test. b Two northern blots probing for the 5.8S 24-mer i-rRF in RNA from nine male and nine female LCLs. Three cell lines from each of CEU, GBR, and YRI were used for each sex. Each lane contains 5 μg of RNA from each sample, and the first lane in each blot has 5 pmol of 5.8S 24-mer target cDNA (lower band). Full-length 5S (ACGUCUGAUCUGAGGUCGCGU) is the top band and served as loading control. rRF bands were normalized to the 121-nt 5S loading control band. Below each blot is a quantification of the 5.8S rRF probe where CEU is represented by purple, GBR is represented by cyan, and YRI is represented by yellow