Table 3 Primers used to obtain mitochondrial (COI) and nuclear (18S, ITS1, 5.8S, ITS2, and 28S) amplicons for sequencing. The primer name is listed with the target organism, the targeted marker, the annealing temperature, the amplicon length, the primer sequence, and the literature reference from which primers were obtained. COI mitochondrial cytochrome c oxidase subunit 1, ITS1 and ITS2 internal transcribed spacer 1 and 2, respectively bp base pairs, and F. nyanzae Fasciola nyanzae. The rDNA region and COI marker of the metacercariae were amplified with the 18S_Dig_F–1270R, ITS4–ITS5, and COI1_Dig_F–NasmitR primer combinations
Primer name | Used on | Marker | Annealing Temp. | Length (bp) | Primer sequence (5′-3′) | Reference |
|---|---|---|---|---|---|---|
WormA | F. nyanzae | 18S | 54 °C | 1870 | GCGAATGGCTCATTAAATCAG | [104] |
WormB | CTTGTTACGACTTTTACTTCC | [104] | ||||
18S_Dig_F | F. nyanzae | 18S | 50 °C | 1161 | CAGCTATGGTTCCTTAGATCRTA | [5] |
1270R | CCGTCAATTCCTTTAAGT | [105] | ||||
ITS5 | F. nyanzae | ITS1-5.8S-ITS2 | 50 °C | 1065 | GGAAGTAAAAGTCGTAACAAG | [106] |
ITS4 | TCCTCCGCTTATTGATATGC | [106] | ||||
ITS2_Dig_F | F. nyanzae | ITS2-28S | 50 °C | 647 | CAAHAAGTCGTGGMTTGG | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
ITS2_Dig_R | AACAACCCGACTCCAAGG | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming | ||||
COI1_Dig_F | F. nyanzae and Stomach flukes | COI | 53 °C | 943 | CNATGATNTTNTTTTTTTTRATGCC | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
Nasmit R | ACATAATGAAARTCAGCNAYMACRA | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming | ||||
COI1_Dig_F | Museum fasciolids | COI | 53 °C | 148 | CNATGATNTTNTTTTTTTTRATGCC | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
COI_FAS_R | GACAAACAAACACAAGCAGG | This study | ||||
Fasc-ITS1 F | Fasciola sp. from infected snails | ITS1-5.8S-ITS2 | 55 °C | 716 | TCTACTCTTACACAAGCGATACAC | [7] |
Fasc-ITS1 R | GGCTTTCTGCCAAGACAAG | [7] | ||||
COI1_Dig_F | Fasciola and Schistosoma sp. from infected snails | COI | 50 °C | 451 | CNATGATNTTNTTTTTTTTRATGCC | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
COI1_Dig_R | GMASWACCAAAWTTHCGATCAAA | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming | ||||
ITS2_Schisto_F | Schistosoma sp. from infected snails | ITS1-5.8S-ITS2 | 62 °C | 369 | GGAAACCAATGTATGGGATTATTG | [42] |
ITS2_Schisto_R | ATTAAGCCACGACTCGAGCA | [42] | ||||
COI1_snail_F | Snails | COI | 50 °C | 536 | TAATTWATTGTTACDGCWCATGC | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
COI1_snail_R | CWCCTCCTGCWGGATCAAA | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |