Primer name | Used on | Marker | Annealing Temp. | Length (bp) | Primer sequence (5′-3′) | Reference |
---|---|---|---|---|---|---|
WormA | F. nyanzae | 18S | 54 °C | 1870 | GCGAATGGCTCATTAAATCAG | [104] |
WormB | CTTGTTACGACTTTTACTTCC | [104] | ||||
18S_Dig_F | F. nyanzae | 18S | 50 °C | 1161 | CAGCTATGGTTCCTTAGATCRTA | [5] |
1270R | CCGTCAATTCCTTTAAGT | [105] | ||||
ITS5 | F. nyanzae | ITS1-5.8S-ITS2 | 50 °C | 1065 | GGAAGTAAAAGTCGTAACAAG | [106] |
ITS4 | TCCTCCGCTTATTGATATGC | [106] | ||||
ITS2_Dig_F | F. nyanzae | ITS2-28S | 50 °C | 647 | CAAHAAGTCGTGGMTTGG | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
ITS2_Dig_R | AACAACCCGACTCCAAGG | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming | ||||
COI1_Dig_F | F. nyanzae and Stomach flukes | COI | 53 °C | 943 | CNATGATNTTNTTTTTTTTRATGCC | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
Nasmit R | ACATAATGAAARTCAGCNAYMACRA | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming | ||||
COI1_Dig_F | Museum fasciolids | COI | 53 °C | 148 | CNATGATNTTNTTTTTTTTRATGCC | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
COI_FAS_R | GACAAACAAACACAAGCAGG | This study | ||||
Fasc-ITS1 F | Fasciola sp. from infected snails | ITS1-5.8S-ITS2 | 55 °C | 716 | TCTACTCTTACACAAGCGATACAC | [7] |
Fasc-ITS1 R | GGCTTTCTGCCAAGACAAG | [7] | ||||
COI1_Dig_F | Fasciola and Schistosoma sp. from infected snails | COI | 50 °C | 451 | CNATGATNTTNTTTTTTTTRATGCC | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
COI1_Dig_R | GMASWACCAAAWTTHCGATCAAA | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming | ||||
ITS2_Schisto_F | Schistosoma sp. from infected snails | ITS1-5.8S-ITS2 | 62 °C | 369 | GGAAACCAATGTATGGGATTATTG | [42] |
ITS2_Schisto_R | ATTAAGCCACGACTCGAGCA | [42] | ||||
COI1_snail_F | Snails | COI | 50 °C | 536 | TAATTWATTGTTACDGCWCATGC | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |
COI1_snail_R | CWCCTCCTGCWGGATCAAA | Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming |