Skip to main content

Table 3 Primers used to obtain mitochondrial (COI) and nuclear (18S, ITS1, 5.8S, ITS2, and 28S) amplicons for sequencing. The primer name is listed with the target organism, the targeted marker, the annealing temperature, the amplicon length, the primer sequence, and the literature reference from which primers were obtained. COI mitochondrial cytochrome c oxidase subunit 1, ITS1 and ITS2 internal transcribed spacer 1 and 2, respectively bp base pairs, and F. nyanzae Fasciola nyanzae. The rDNA region and COI marker of the metacercariae were amplified with the 18S_Dig_F–1270R, ITS4–ITS5, and COI1_Dig_F–NasmitR primer combinations

From: Invasive snails, parasite spillback, and potential parasite spillover drive parasitic diseases of Hippopotamus amphibius in artificial lakes of Zimbabwe

Primer name Used on Marker Annealing Temp. Length (bp) Primer sequence (5′-3′) Reference
WormA F. nyanzae  18S  54 °C  1870  GCGAATGGCTCATTAAATCAG [104]
WormB CTTGTTACGACTTTTACTTCC [104]
18S_Dig_F F. nyanzae 18S 50 °C 1161 CAGCTATGGTTCCTTAGATCRTA [5]
1270R CCGTCAATTCCTTTAAGT [105]
ITS5 F. nyanzae ITS1-5.8S-ITS2 50 °C 1065 GGAAGTAAAAGTCGTAACAAG [106]
ITS4 TCCTCCGCTTATTGATATGC [106]
ITS2_Dig_F F. nyanzae ITS2-28S 50 °C 647 CAAHAAGTCGTGGMTTGG Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming
ITS2_Dig_R AACAACCCGACTCCAAGG Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming
COI1_Dig_F F. nyanzae and Stomach flukes COI 53 °C 943 CNATGATNTTNTTTTTTTTRATGCC Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming
Nasmit R ACATAATGAAARTCAGCNAYMACRA Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming
COI1_Dig_F Museum fasciolids COI 53 °C 148 CNATGATNTTNTTTTTTTTRATGCC Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming
COI_FAS_R GACAAACAAACACAAGCAGG This study
Fasc-ITS1 F Fasciola sp. from infected snails ITS1-5.8S-ITS2 55 °C 716 TCTACTCTTACACAAGCGATACAC [7]
Fasc-ITS1 R GGCTTTCTGCCAAGACAAG [7]
COI1_Dig_F Fasciola and Schistosoma sp. from infected snails COI 50 °C 451 CNATGATNTTNTTTTTTTTRATGCC Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming
COI1_Dig_R GMASWACCAAAWTTHCGATCAAA Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming
ITS2_Schisto_F Schistosoma sp. from infected snails  ITS1-5.8S-ITS2  62 °C  369  GGAAACCAATGTATGGGATTATTG [42]
ITS2_Schisto_R ATTAAGCCACGACTCGAGCA [42]
COI1_snail_F Snails  COI  50 °C  536  TAATTWATTGTTACDGCWCATGC Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming
COI1_snail_R CWCCTCCTGCWGGATCAAA Hammoud C, Mulero S, Van Bocxlaer B, Boissier J, Verschuren D, Albrecht C, Huyse T: Simultaneous genotyping of snails and infecting trematode parasites using high-throughput amplicon sequencing, forthcoming