Skip to main content

Table 2 Primers for RT-qPCR

From: Long non-coding RNA Tug1 modulates mitochondrial and myogenic responses to exercise in skeletal muscle

Gene target Forward primer (5′-3′) Reverse primer (5′-3′) Amplicon length (bp) Transcript variants amplified NCBI accession ID of first variant
Human
TUG1 AGCGTGGGTGTACGTAAAGG CCAAGGATTGGGGAACTGCT 82 1,2,3,6,7,8 NR_110492.1
PPARGC1A TGAGAGGGCCAAGCAAAG ATAAATCACACGGCGCTCTT 64 1-7 >NM_001330751.2
TFAM GAACAACTACCCATATTTAAAGCTCA GAATCAGGAAGTTCCCTCCA 95 1,2 >NM_003201.3
GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC 66 1,3,4,7 >NM_002046.7
Mouse
Tug1 GAGACACGACTCACCAAGCA GAAGGTCATTGGCAGGTCCA 165 a,b,c >NR_002321
Ppargc1a TCCTCTTCAAGATCCTGTTAC CACATACAAGGGAGAATTGC 78 1-9 >NM_008904.2
Nrf1 AAACAAAGGGTTTCATGGAC GGTACGAGATGAGCTATACTG 149 1-10 >NM_001164226.1
Gabpa (Nrf2) CAAGTATTGACAGTACCAGC CTCTCTCTTCAATTTCTGCAC 127 1,4,5,9 >NM_207669.2
Myod CTGGTTCTTCACGCCCAAA CTGGAAGAACGGCTTCGAAGG 74 1 >NM_010866.2
Myog GGGGCAATGCACTGGAGTTC GCAGATTGTGGGCGTCTGTA 78 1 >NM_031189.2
Gapdh GCCTGGAGAAACCTGCCAA CGAAGGTGGAAGAGTGGGAG 144 1,3 >NM_001289726.1