Table 2 Microsatellite loci used in the study. Name, GenBank accession numbers, repeat motif and primer sequences (F: forward, R: reverse primer) are given for the three newly developed microsatellite loci for L. neglectus. For other loci see Fjerdingstad et al [58]. The product size in basepairs (bp) and the optimal annealing temperature in degrees Celsius (°C) are shown for L. neglectus. N, number of studied populations of L. neglectus; n, number of individuals; k, observed number of alleles; H o, observed heterozygosity; H e, expected heterozygosity assuming no genetic differentiation among populations.
Locus | Accession number | Repeat motif | Primer sequence (5'-3') | Product size (bp) | Annealing temperature (°C) | N | n | k | H o | H e |
|---|---|---|---|---|---|---|---|---|---|---|
Lng-1 | [GenBank:EU057967] | (CA)5T (AC)2AA (CA)13 | F: TCTCGCTCCAACTACTTAAA R: TTGTCTTCAAATTGTCCAAC | 204–220 | 55 | 14 | 417 | 6 | 0.37 | 0.64 |
Lng-3 | [GenBank:EU057968] | (CA)14 | F: GATGCCAAGTTTACATGG R: CACAATACTCACATATTCACAA | 112–132 | 55 | 14 | 417 | 6 | 0.06 | 0.11 |
Lng-4 | [GenBank:EU057969] | (CA)11 | F: GTGAACGAATATATCATGGAT R: CGTTGACGAAAATAGCTC | 159–167 | 55 | 14 | 415 | 4 | 0.06 | 0.11 |
L1–5 | -- | -- | -- | 285–301 | 55 | 14 | 402 | 9 | 0.56 | 0.81 |
L10–174 | -- | -- | -- | 234–298 | 62 | 14 | 416 | 20 | 0.42 | 0.88 |
L10–282 | -- | -- | -- | 256–258 | 55 | 14 | 414 | 2 | 0.02 | 0.02 |