Skip to main content

Table 2 Quantitative PCR primer sequences used in this study

From: Integration-deficient lentivectors: an effective strategy to purify and differentiate human embryonic stem cell-derived hepatic progenitors

Gene Direction Primer sequence 5′→3′
CK19 Forward TGAGTGACATGCGAAGCCAATAT
Reverse GCGACCTCCCGGTTCAAT
HPRT Forward TAATGGTGGAGATGATCTCTCAAC
  Reverse TGCCTGACCAAGGAAAGC