Skip to main content

Table 4 New primer sequences designed for this study

From: Systematics and plastid genome evolution of the cryptically photosynthetic parasitic plant genus Cuscuta(Convolvulaceae)

Primer name Sequence (5' to 3')
rbcL-Z1Cus ATGTCACCACAAACAGARACTAAARC
rbcL-521F CTATTAAACCWAAATTGGGKTTATC
rbcL-599R GTAAAATCAAGTCCACCRCGAAG
rbcL-818F GATTCACTGCAAATACTTCTTTGG
rbcL-910R GTCTATCAATAACKGCATGCATTG
rbcL-1392R CTCYTTCCATACCTCACAAGCAG
rps2-J12F ATATTGGAACATMAAWTTGGAAG
rps2-J662R CYAATTTGTTMAGAATGAATCG
rps2-J306F CGGTATGTTAACRAATTGGTCCAC
rps2-J458R CCCAGATATMTTTGCAAGCGAGC
petD-endF CAAAATCCATTTCGKCGTCCAG
rps11-C398F GCCACACAATGGCTGTAGACCTCC