Skip to main content

Table 2 Genes and primers used in polymerase chain reaction (PCR) assays to detect reproductive parasites and control DNA quality

From: The diversity of reproductive parasites among arthropods: Wolbachiado not walk alone

Organism Gene Primer (5' – 3') Annealing temperature Positive control Size Reference
Arthropods 18S rDNA NSF4/18 – CTGGTTGATYCTGCCAGT * 54°C Any arthropod 400–450 bp [72, 73]
Rickettsia sp. 17-kDa R1 – GCTCTTGCAACTTCTATGTT * 54°C Adalia decempunctata 434 bp [67]
Wolbachia pipientis 16S rDNA 16Swolb76-99f – TTGTAGCCTGCTATGGTATAACT * 54°C Culex pipiens 896 bp [74]
   16Swolb1012-994r – GAATAGGTATGATTTTCATGA *     
  wsp 81F – TGGTCCAATAAGTGATGAAGAAAC 50°C 81F/522R: Aedes albopictuswAlbB 442 bp [75]
   136F – TGAAATTTTACCTCTTTTC   172F/691R: Aedes albopictuswAlbA 514 bp  
   172F – ACCTATAAGAAAGACAAG   81F/484R: Protocalliphora sp.wA2 380 bp  
   484R – TTTGATCATTCACAGCGT   136F/691R: Protocalliphora sp.wA1 516 bp  
Arsenophonus nasoniae 16S rDNA ArsF – GGGTTGTAAAGTACTTTCAGTCGT * 52°C ArsF, ArsF3/ArsR2, ArsR3: Nasonia vitripennis 581–804 bp This study
   ArsF2 – CCCTAAGCTTAACTTAGGA *   ArsF2/ArsR2: Polistes nympha 612 bp  
Cardinium hertigii 16S rDNA CLO-f1 – GGAACCTTACCTGGGCTAGAATGTATT * 54°C Holocnemus pluchei CLO-f1/CLO-r1: 466 bp [13]
Flavobacterium sp. 16S rDNA FlavF – CGAATAAGTRTCGGCAAACTCCG * 52°C Coleomegilla maculata 530 bp This study
Spiroplasma ixodetis 16S rDNA SpixoF – TTAGGGGCTCAACCCCTAACC * 52°C Adalia bipunctata 810 bp This study
S. poulsonii 16S rDNA SpoulF – GCTTAACTCCAGTTCGCC * 55°C Drosophila melanogaster 421 bp [42]
  1. The sizes of PCR products provided are those of positive controls in base pairs (bp). *Primers used in initial screen of the arthropod collection; the other primers were used to obtain additional sequences.