Skip to main content

Table 3 Primers used for PCR amplification and sequencing.

From: Evolution and diversity of Rickettsiabacteria

Gene Description Primer name Primer sequence (5'-3') Reference
16S 16S rDNA 27f AGAGTTTGATCCTGGCTCAG [81]
   rssur GAAAGCATCTCTGCGATCCG [15]
atpA ATP synthase F1 alpha subunit atpAf2 ATCAAGCGTTGCACAGATAG this study
   Vitr CGACTTACCGAAATACCGAC [33]
   atpA536r GGAAGTGCCGTAAGTGAACC this study
gltA citrate synthase rcit133f GGTTTTATGTCTACTGCTTCKTG [10]
   rcit1197r CATTTCTTTCCATTGTGCCATC [10]
coxA subunit I of cytochrome C oxidase coxAf2 ACAGCCGTTGATATGGCTA this study
   coxA1413r CATATTCCAACCGGCAAAAG this study
   coxA322f GGTGCTCCTGATATGGCATT this study
   coxAr1 CATATTCCAGCCGGCAAAAG this study
  1. For AtpA, the primers used in tandem are atpAf2 as a forward primer and either VitR or atpA536r as reverse primers. For amplification of coxA, the primers used are coxAF2 with coxA1413r or coxA322f with coxAr1.