Skip to main content

Table 1 List of primers used for 3'RACE, real time polymerase chain reaction (PCR), multiplex PCR, genotyping, and northern probe preparation. All primer sequences are in 5'-3' direction.

From: Identification and characterization of Dlc1 isoforms in the mouse and study of the biological function of a single gene trapped isoform

Primers for 3'RACE    
1st strand CDNA synthesis CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT
  Forward primers Reverse primers Sequencing primers
1st round PCR CTATCAGAAAGAGGAGCTGGGAAG
AGACCGAACAGCCTTTTATTTCTG
ACGTCTTAGCAGCTCCTTATGTAG
ACAAAAGCACTCTCGGGGTCAG
AAACTGGACCAACTAGACCAAGAC
ATCTGAATTGCACAGGCAAAACAG
GCCCTAAGCCTTTCCAGATG
CTGCGCCGACCTTAATGTGTAG
CCAGTGAGCAGAGTGACG  
2nd round PCR CTATCAGAAAGAGGAGCTGGGAAG
AGACCGAACAGCCTTTTATTTCTG
ACGTCTTAGCAGCTCCTTATGTAG
ACAAAAGCACTCTCGGGGTCAG
AAACTGGACCAACTAGACCAAGAC
ATCTGAATTGCACAGGCAAAACAG
TCCTTCAGCGACCACATCAGAG
CGCCGACCTTAATGTGTAGAGAC
GAGGACTCGAGCTCAAGC ATTTTTTTTTTTTTTTTTTTTT
GTTTTTTTTTTTTTTTTTTTTT
CTTTTTTTTTTTTTTTTTTTTT
& different forward primers
Primers for Northern probe
1st round PCR CTGCGCCGACCTTAATGTGTAG GTTGCAGTCACGGGTGCTTC  
2nd round PCR CTCGAGCTGCGCCGACCTTAATGTGTAG GTCGACGTTGCAGTCACGGGTGCTTC  
Primers for real time quantification of splice variants
7.6 Kb transcript TCCACCGATCCATCATCCACTC CGGTGAGGACTGATCTCCAGCTTCATG  
6.2 Kb transcript TCCTTCAGCGACCACATCAGAG GACTGGTTTCCCCCAGTATGCA  
6.1 Kb transcript CGCCGACCTTAATGTGTAGAGAC   
2.1 Kb transcript TCCACCGATCCATCATCCACTC GCCCACTGAGTGCTGAGACTG
AAGTAC
 
GAPDH TTC CGT GTT CCT ACC CCC AAT GTGT GGAGTTGCTGTTGAAGTCGCAGGAG  
Primers for methylation study
6.1 Kb Transcript Biotin-GTAAGAAAAGGTAGAGGGGAAATTGAGTA CTCCTTCCCCCTTTCCTAAAATAT TTTTCCCAAAATCTACACT
6.2 Kb transcript TAGGAGGTTAGTATGGGTTGTA Biotin-AAACCTAATACTAACATAAAACAATATC AAATTGTTTTTTTGATTTTAA
Multiplex PCR primers for genotyping Dlc1 gene trap embryos
  TCCTGCTGGTGTGTGTAAACAGAC GTGTAAGTTTGCCTCCTCCTTTGG  
  GATTCCACCGCCGCCTTCTATG TCAAGCAAAAAGGTCTCGTATGTTGTG  
Multiplex PCR primers for fusion transcripts
(7.6+2.1)Kb transcript TCCACCGATCCATCATCCACTC ACGACGACAGTATCGGCCTCAG  
6.2 Kb transcript TCCTTCAGCGACCACATCAGAG   
6.1 Kb transcript CGCCGACCTTAATGTGTAGAGAC