Skip to main content

Table 1 Primers used for the generation of recombinant mouse monoclonal antibodies.

From: A rapid and scalable method for selecting recombinant mouse monoclonal antibodies

Primers used for the generation of a leader sequence for the κ light chains
1 GCCACCATGGAGTTTCAGACCCAGGTACTCATGTCCCTGCTGCTCTGCATGTCTGGTGC
2 GGCCGCACCAGACATGCAGAGCAGCAGGGACATGAGTACCTGGGTCTGAAACTCCATGGTGGC
Degenerate forward primers used for the amplification of rearranged κ light chains
3 TCAATAGTTGAACATAGCGGCCGCASAAAWTGTKCTCACCCAGTC
4 TCAATAGTTGAACATAGCGGCCGCAGAWATTGTGCTMACTCAGTC
5 TCAATAGTTGAACATAGCGGCCGCAGACATTGTGCTRACACAGTC
6 TCAATAGTTGAACATAGCGGCCGCAGACATTGTGATGACMCAGTC
7 TCAATAGTTGAACATAGCGGCCGCAGAYATCMAGATRAMCCAGTC
8 TCAATAGTTGAACATAGCGGCCGCAGAYATCCAGATGAYTCAGTC
9 TCAATAGTTGAACATAGCGGCCGCAGATATCCAGATGACACAGAC
10 TCAATAGTTGAACATAGCGGCCGCAGACATTGTGCTGACCCAATC
11 TCAATAGTTGAACATAGCGGCCGCAGACATYSTRATGACCCARTC
12 TCAATAGTTGAACATAGCGGCCGCAGATRTTKTGATGACYCARAC
13 TCAATAGTTGAACATAGCGGCCGCAGAYATTGTGATGACBCAGKC
14 TCAATAGTTGAACATAGCGGCCGCAGATATTGTGATAACCCAGGA
15 TCAATAGTTGAACATAGCGGCCGCAGACATCYTGCTGACYCAGTC
16 TCAATAGTTGAACATAGCGGCCGCAGAAAWTGTGYTGACCCAGTC
17 TCAATAGTTGAACATAGCGGCCGCAGAAACAACTGTGACCCAGTC
18 TCAATAGTTGAACATAGCGGCCGCAGACATTRTGATGWCACAGTC
19 TCAATAGTTGAACATAGCGGCCGCAGACATCCAGMTGACMCARTC
Reverse primer used for the amplification of rearranged κ light chains
20 GGATACAGTTGGTGCAGCATCAGCCC
Primers used for the generation of the joining fragment
21 GGGCTGATGCTGCACCAACTGTA
22 TCAAGTGCAAAGACTCACTTTATTG
23 CAATAAAGTGAGTCTTTGCACTTGATAGTTATTAATAGTAATCAATTACG
24 TAGCAGAACAGGCAGCTTCATGGTGGCCTGGGAGTGGACACCTGTGGAGAG
25 ATGAAGCTGCCTGTTCTGCTAGTG
26 ACTGCTTGAGGCTGGACTCGTGAACAATAGCAGC
Degenerate forward primers used for the amplification of rearranged heavy chains
27 TTCACGAGTCCAGCCTCAAGCAGTGAKRTRCAGCTTMAGGAGTC
28 TTCACGAGTCCAGCCTCAAGCAGTGAGKTYCAGCTBCAGCAGTC
29 TTCACGAGTCCAGCCTCAAGCAGTCAGGTGCAGMTGAAGSAGTC
30 TTCACGAGTCCAGCCTCAAGCAGTGAGRTCCAGCTGCAACARTC
31 TTCACGAGTCCAGCCTCAAGCAGTCAGGTYVAGCTGCAGCAGTC
32 TTCACGAGTCCAGCCTCAAGCAGTCAGGTYCARCTGCAGCAGTC
33 TTCACGAGTCCAGCCTCAAGCAGTGAGGTGMAGCTGGTGGAATC
34 TTCACGAGTCCAGCCTCAAGCAGTGAVGTGMWGCTSGTGGAGTC
35 TTCACGAGTCCAGCCTCAAGCAGTGARGTGCAGCTGKTGGAGWC
36 TTCACGAGTCCAGCCTCAAGCAGTGAGGTGAAGCTGATGGAATC
37 TTCACGAGTCCAGCCTCAAGCAGTGAGGTGCAGCTTGTTGAGTC
38 TTCACGAGTCCAGCCTCAAGCAGTGAGGTGAAGCTTCTCRAGTC
39 TTCACGAGTCCAGCCTCAAGCAGTGAAGTGAARMTTGAGGAGTC
40 TTCACGAGTCCAGCCTCAAGCAGTCAGGTTACTCWGAAAGWGTCTG
41 TTCACGAGTCCAGCCTCAAGCAGTCAGGTCCAACTGCAGCAGCC
42 TTCACGAGTCCAGCCTCAAGCAGTGATGTGAACCTGGAAGTGTC
43 TTCACGAGTCCAGCCTCAAGCAGTCAGATCCAGTTSGTRCAGTC
44 TTCACGAGTCCAGCCTCAAGCAGTGAGGTRCAGCTKGTAGAGAC
Reverse primers used for the amplification of rearranged heavy chains
45 CTATTCTAGCTAATCTAGGCGCGCCGAGGAGACGGTGACCGTGGTCC
46 CTATTCTAGCTAATCTAGGCGCGCCGAGGAGACTGTGAGAGTGGTGC
47 CTATTCTAGCTAATCTAGGCGCGCCGCAGAGACAGTGACCAGAGTCC
48 CTATTCTAGCTAATCTAGGCGCGCCGAGGAGACGGTGACTGAGGTTC
Primers used for the amplification of the IgG1 constant region
49 ATATCACGGCGCGCCCGACACCCCCATCTGTCTATCCA
50 GACTGATCTAGATCATTTACCAGGAGAGTGGGAGAG
Primers used for fusion polymerase chain reaction
51 TCAATAGTTGAACATAGCGGCCGC
52 CTATTCTAGCTAATCTAGGCGCGCCG
Primer specific for the aberrant κ light chain from SP2/0 myeloma
53 GGATGCTGCAACCTATTACTGTCAGCACATTAGGGAGCTTACACG
  1. The primers used to amplify the rearranged heavy and kappa light variable regions were designed using recent genome sequence of the mouse immunoglobulin regions: NG_005612 for the κ light locus and NG_005838 for the heavy locus. Degenerate base code: M = A+C; R = A+G; W = A+T; S = C+G; Y = C+T; K = G+T; V = A+C+G; B = C+G+T.