Skip to main content

Table 3 RT-PCR primers

From: PCI proteins eIF3e and eIF3m define distinct translation initiation factor 3 complexes

Gene Name Sequence Product Size (bp)
actinF GAGCTTCCTGATGGTCAAGT 200
actinR GGATACATAGTGGTACCACC  
cdc16F AAGTTAGCGCCCAAATCACC 150
cdc16R TTTTGAATGCCCCCCCACGG  
gar2F GGTGCCATTGAGAAACCTTC 150
gar2R CCGAACCTTCAAAGAAATCA  
pof6F TCTGATCGGCCTAAGCTGTC 150
pof6R CAATCTTGCAAATTCAACTC  
rpn5F TGAGAAGCAAGTTCGTCAGG 160
rpn5R TGAAACAATCGATGACAAGT  
rps8-1F AAGCGTATTCACGAGGTCCG 150
rps8-1R CAACTCGTTGTTAGAAGGGT  
scd1F TCAGAGTTGGCTGCTTTCTT 150
scd1R ATCCATTGTGTGCCCTGTTC  
SPAC1348.05F CTTAGTGAACAGTTTGGAAG 150
SPAC1348.05R TGATAAACCAACGGATCCGA  
SPAC21E11.04F GAGACATCACCTGCTCCAGA 150
SPAC21E11.04R TTTGCTCCGGTGACTAGGTG  
SPBC12C2.06F TCTGTTCCCAAACCTCAAGC 150
SPBC12C2.06R ATCGATTTTTGCACCTTTAG  
SPBC1683.01F GGCCGTAAATTTGTCTACGG 150
SPBC1683.01R ACCACCAATACCAACACCAA  
SPBC36B7.03F CTCTCAATTAAATTTCACCC 150
SPBC36B7.03R AGGAGTACCGTATAAAGCAT  
SPCC70.05cF GTACCTGGAAATAACTCTCC 150
SPCC70.05cR CATAGCCTTTTCTAAGAGAT  
tf2-12F AAGCATGTACCAGAGATAGG 150
tf2-12R TGAATCACCTAGAAGAATTA  
ung1F ACTTTGGAGAGTTCTTGGTT 150
ung1R TGGAGTATGATGTGACCATG  
  1. F = Forward; R = Reverse