Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

HP1a-mediated heterochromatin formation promotes antimicrobial responses against Pseudomonas aeruginosa infection

BMC Biology volume 20, Article number: 234 (2022) Cite this article

Abstract

Background

Pseudomonas aeruginosa is a Gram-negative bacterium that causes severe infectious disease in diverse host organisms, including humans. Effective therapeutic options for P. aeruginosa infection are limited due to increasing multidrug resistance and it is therefore critical to understand the regulation of host innate immune responses to guide development of effective therapeutic options. The epigenetic mechanisms by which hosts regulate their antimicrobial responses against P. aeruginosa infection remain unclear. Here, we used Drosophila melanogaster to investigate the role of heterochromatin protein 1a (HP1a), a key epigenetic regulator, and its mediation of heterochromatin formation in antimicrobial responses against PA14, a highly virulent P. aeruginosa strain.

Results

Animals with decreased heterochromatin levels showed less resistance to P. aeruginosa infection. In contrast, flies with increased heterochromatin formation, either in the whole organism or specifically in the fat body—an organ important in humoral immune response—showed greater resistance to P. aeruginosa infection, as demonstrated by increased host survival and reduced bacterial load. Increased heterochromatin formation in the fat body promoted the antimicrobial responses via upregulation of fat body immune deficiency (imd) pathway-mediated antimicrobial peptides (AMPs) before and in the middle stage of P. aeruginosa infection. The fat body AMPs were required to elicit HP1a-mediated antimicrobial responses against P. aeruginosa infection. Moreover, the levels of heterochromatin in the fat body were downregulated in the early stage, but upregulated in the middle stage, of P. aeruginosa infection.

Conclusions

These data indicate that HP1a-mediated heterochromatin formation in the fat body promotes antimicrobial responses by epigenetically upregulating AMPs of the imd pathway. Our study provides novel molecular, cellular, and organismal insights into new epigenetic strategies targeting heterochromatin that have the potential to combat P. aeruginosa infection.

Background

The widely distributed Gram-negative bacteria Pseudomonas aeruginosa causes infections in diverse host organisms [1]. It is an opportunistic pathogen and major cause of human infection and death in hospitals due to its high virulence and multidrug resistance (MDR) [2, 3]. The serious infections caused by P. aeruginosa occur mainly in severely ill and immunocompromised patients [4, 5]. However, P. aeruginosa rarely causes severe infection in normal, immunocompetent hosts, suggesting that antimicrobial responses play a critical role in resistance to P. aeruginosa infection [6]. Antimicrobial responses involve innate immune activation, which is responsible for early recognition of invading pathogens and their clearance [7]. The innate immune cells are first responders that are activated by pathogens, such as bacteria and viruses. In response to bacterial infection, the activated innate immune cells produce antimicrobial peptides (AMPs) that eliminate the pathogens. Notably, the natural AMPs act as barriers that protect human skin and airway epithelium from bacterial infection [8, 9] and have drawn great interest as targets in the development of drugs to fight MDR bacteria, including P. aeruginosa [10, 11]. It is therefore critical to understand the regulation of host innate immune responses to P. aeruginosa infection as a guide in development of effective therapeutic options [12].

Innate immune responses are evolutionarily conserved from invertebrates to humans and are dependent upon conserved signaling cascades and expression of innate immune responsive genes [13]. Gene expression is epigenetically controlled by chromatin state, which is also a conserved mechanism in higher eukaryotes, while growing evidence supports a role of chromatin state in the regulation of innate immune responsive gene transcription [14, 15]. Posttranslational modification of histone tails plays a major role in epigenetic gene regulation by mediating the transition of chromatin between the loose euchromatin and compact heterochromatin states [16,17,18]. Histone 3 lysine 9 di/tri-methylation (H3K9me2/3) marks a major type of heterochromatin with the binding of their reader, heterochromatin protein 1a (HP1a), to promote heterochromatin formation [19,20,21,22,23]. HP1a can form bridges between nucleosomes [24,25,26] and recruit the writer, H3K9 methyltransferases, to methylate H3K9 [27]; these processes further promote heterochromatic propagation [17]. Thus, HP1a protein and H3K9me2/me3 modification contribute to heterochromatin formation and maintenance. Recent evidence showed that heterochromatin formation participates in cellular immune responses, such as macrophage activation [28] and cancer cells with innate immune activation [29]. Several studies have demonstrated that heterochromatin contributes to immune responses of innate immune cells via H3K9 methylation of immune responsive genes [30,31,32]. However, the molecular and cellular mechanisms by which HP1a-mediated heterochromatin formation regulates innate immune responses against P. aeruginosa infection remain elusive.

The model organism Drosophila melanogaster plays a critical role in studies of human innate immunity. Drosophila have similar innate immune pathways to human NF-kB signaling, including immune deficiency (imd) and Toll, which initiate the cascade of innate immune responses [33]. The imd pathway, which includes many kinds of peptidoglycan recognition proteins (PGRP), is important in antimicrobial responses to Gram-negative bacteria, while the Toll pathway responds preferentially to Gram-positive bacteria [34]. The cascades of the imd and Toll pathways mediate nuclear import of NF-kB homologs, which upregulate expression of AMPs that protect against invading bacteria [33, 35]. Suppression of those AMPs increases the susceptibility of Drosophila to virulent P. aeruginosa infection [36, 37]. The Drosophila fat body is the major immune organ active in humoral responses involving secretion of AMPs, and it is activated by imd and Toll signaling upon systemic bacterial infection [38]. Thus, it raises the interesting question of whether HP1a-mediated heterochromatin formation in the fat body regulates innate immune responses against P. aeruginosa infection.

To determine the role of HP1a-mediated heterochromatin formation in innate immune responses, we manipulated heterochromatin levels through whole body overexpression of HP1a to elicit gain of function, by using HP1a mutant flies that demonstrate loss of HP1a function, or through overexpression of HP1a specifically in the fat body. These experimental models were used to investigate the role of heterochromatin levels in antimicrobial responses upon systemic P. aeruginosa PA14 infection. Our results demonstrate that elevated HP1a-mediated heterochromatin formation in the fat body increases survival and decreases bacterial loads upon P. aeruginosa infection. Mechanistically, we found that fat body heterochromatin formation promotes the upregulation of imd pathway-mediated AMPs before, and in the middle stage of, P. aeruginosa infection. Importantly, the imd pathway-mediated AMPs, including Diptericin A (DptA), were required to support HP1a-mediated antimicrobial responses after P. aeruginosa infection. Furthermore, during P. aeruginosa infection, an early stage decrease in fat body heterochromatin levels was observed, followed by increased levels in the middle stage. These results provide molecular, cellular, and organismal level insights regarding HP1a and heterochromatin mediated epigenetic control of antimicrobial responses against P. aeruginosa infection.

Results

Increased formation of heterochromatin in the whole organism or the fat body of Drosophila promotes resistance to P. aeruginosa infection

To establish a Drosophila-based platform for exploring antimicrobial responses to P. aeruginosa infection, we used the surgical wound method to conduct infection of adult male wild type (WT) flies with P. aeruginosa PA14 at 3-5 days post-eclosion, which caused inoculum-dependent lethality (Additional file 1: Fig. S1A). Importantly, flies with ubiquitous induction of heterochromatin formation via overexpression of HP1a showed greater resistance to P. aeruginosa versus WT flies, whereas HP1a loss-of-function mutant flies, which have decreased heterochromatin levels, were more vulnerable compared to WT (Additional file 1: Fig. S1B, C) [39, 40]. The Drosophila fat body (Fig. 1A) is the primary organ responsible for immune defense. Therefore, we determined whether local, tissue-specific induction of heterochromatin formation in the fat body would counteract systemic P. aeruginosa infection. Survival of flies with fat body-specific overexpression of HP1a by C564 [41], an independent fat body driver, was increased (Fig. 1B, C, Additional file 1: Fig. S2A-D). Moreover, we inoculated flies with lower P. aeruginosa doses and found that increased fat body HP1a-mediated heterochromatin promotes host resistance to PA14 infection with a lower bacterial dose (Additional file 1: Fig. S3). However, knockdown of HP1a in the fat body did not affect host susceptibility to infection (Additional file 1: Fig. S4A, B). These results suggest that HP1a-mediated heterochromatin formation improves host resistance against P. aeruginosa, and increased heterochromatin formation in fat body tissue alone is sufficient to promote host resistance.

Fig. 1
figure 1

Increased HP1a-mediated heterochromatin formation in the fat body promotes resistance against systemic P. aeruginosa PA14 infection. A Systemic P. aeruginosa PA14 infection was achieved through surgical wound via needle pricking of the Drosophila thorax. The immune organ (fat body) is located in the abdomen. B, C The survival curve and median survival of flies with fat body-specific C564-driven HP1a overexpression, compared to control, after PA14 infection. D, E The survival curve and median survival of flies with RU486-inducible fat body specific HP1a overexpression after PA14 infection. Control and treated flies received food with either EtOH (vehicle) or RU486, respectively, for 4 days upon eclosion. F Exposure to RU486 did not reduce, but rather increased, susceptibility and reduced survival of S106-GS>+ expressing flies after PA14 infection. For survival curves, n = 40 flies/group and *p < 0.05, ***p < 0.001 by log-rank test. For median survival, data are shown as mean ± SD from 4-5 independent experiments and *p < 0.05 by Student’s t-test. Inoculum of OD600 = 0.1

Full size image

To eliminate the confounding factors due to genetic background variability in fly strains, we used the inducible Gene Switch (GS) system for conditional fat body-specific HP1a overexpression. As shown in Additional file 1: Fig. S5, the green fluorescent protein (GFP) signal was prominently detected in the abdomen of flies carrying the fat body-specific S106-GS Gal4 driver [42] in combination with the UAS-nuclear GFP transgene after receiving food containing 600 μM RU486. These data demonstrate effective and location-specific induction of the fat body driver-linked gene expression. Temporal overexpression of HP1a in the fat body via this RU486-inducible expression system conferred elevated host resistance against P. aeruginosa PA14 infection (Fig. 1D, E, Additional file 1: Fig. S2E-G). Moreover, dietary exposure to RU486 did not promote resistance, but rather increased vulnerability of the control flies (i.e., the progeny of the S106-GS Gal4 driver line crossed to the w1118 strain) to P. aeruginosa infection (Fig. 1F). Since Drosophila do not possess acquired/adaptive immune responses, these results suggest that upregulating the level of heterochromatin formation in the host genome could increase the effectiveness of innate defense responses. Taken together, our data demonstrate that heterochromatin formation, especially in the fat body, plays an important role in promoting resistance to P. aeruginosa infection.

Increased heterochromatin formation in the fat body reduces P. aeruginosa loads within infected adult flies

The course of P. aeruginosa infection is divided into early (0–15 h post infection [hpi]), middle (15–30 hpi), and late (beyond 30 hpi) stages based on the survival curve, as depicted in Fig. 2A. The flies began dying at 30 hpi (used to determine the middle and late stages) with the halfway time point set at 15 hpi (used to determine the early and middle stages). Since the Drosophila fat body is the main immune response tissue that secretes AMPs for the elimination of invading bacteria, we sought to determine the bacterial clearance capacity arising from fat body-specific HP1a overexpression by monitoring the viable bacterial load within the flies, recorded as colony-forming units (CFU) per fly at different time points: 0, 9, 15, 21, 27, and 33 h after challenge with P. aeruginosa PA14. Bacterial loads/CFU counts of C564-driven HP1a flies showed significant clearance and were decreased by 57% at 27 hpi (Fig. 2B). Moreover, consistent with our findings in Fig. 1B, we found that fat body-specific overexpression of HP1a using an alternative fat body driver, Lsp2 [43], also increased survival after P. aeruginosa infection (Additional file 1: Fig. S6A-F) and decreased bacterial loads by 86% at 27 hpi compared to control flies (Additional file 1: Fig. S6G). It is noteworthy that increased HP1a-mediated heterochromatin formation promoted bacterial clearance at 27 hpi (Fig. 2B), before the middle-to-late stage transition of P. aeruginosa infection, but not earlier (at 21 hpi) in the middle stage or after (at 33 hpi) in the late stage of the infection (Additional file 1: Fig. S7). Together, these results suggest that increased fat body heterochromatin formation reduces the bacterial load associated with P. aeruginosa infection.

Fig. 2
figure 2

Increased fat body heterochromatin formation reduces the bacterial loads of P. aeruginosa. A Schematic of fly collection at different time points in the early, middle, and late stages of PA14 infection for the CFU measurement. CFU results for time points indicated by blue circles are presented in Fig. S5. B Bacterial loads of C564-driven HP1a and control flies were counted at 0, 15, and 27 hpi. CFU experiments at 15 and 27 hpi are representative of 5 independent experiments, and each experiment included 5 flies for the CFU measurement. CFU experiments at 0 hpi are representative of 5 independent experiments, and each experiment included 1 fly for the CFU measurement. *p < 0.05 by Student’s t-test. CFU, colony forming unit; hpi, hrs post infection; ns, not significant

Full size image

Increased heterochromatin formation in cells of the Drosophila fat body promotes imd-mediated antimicrobial responses against P. aeruginosa infection

To further determine the molecular mechanisms by which HP1a-mediated heterochromatin formation regulates innate immune responses, we examined whether the imd pathway, which is critical for antimicrobial responses to Gram-negative bacteria, participates in the fat body heterochromatin formation-induced antimicrobial immune response against Gram-negative P. aeruginosa PA14 infection (Fig. 3A). We first confirmed that fat body cell HP1a mRNA is upregulated by 150-fold in flies with C564-driven HP1a and HP1a; imdRNAi compared to control flies and that fat body cell imd mRNA is downregulated by 90% in flies with C564-driven imdRNAi and HP1a; imdRNAi compared to control flies (Fig. 3B, C). Importantly, HP1a and imd mRNA levels were not affected in the C564>imdRNAi and C564>HP1a flies, respectively, compared to control flies. These results suggest that overexpression and knockdown of HP1a and imd, respectively, work effectively and specifically in the fat body. Next, we investigated the host resistance in the flies with fat body-specific C564-driven +, HP1a, imdRNAi, and HP1a; imdRNAi after P. aeruginosa infection. Flies with increased fat body heterochromatin formation by HP1a overexpression had consistently increased resistance to P. aeruginosa infection compared to controls, and hypoactivation of the imd pathway by imd downregulation decreased that resistance (Fig. 3D). While imd downregulation in the fat body impaired heterochromatin formation-induced antimicrobial responses, increased fat body cell heterochromatin formation in the flies with imd knockdown restored the host resistance to P. aeruginosa infection to the same level observed in C564-driven + controls. Together, these results suggest that HP1a-mediated heterochromatin formation promotes imd-mediated antimicrobial responses against P. aeruginosa infection.

Fig. 3
figure 3

The imd-mediated antimicrobial response in the Drosophila fat body is necessary for heterochromatin-mediated resistance to P. aeruginosa infection. A The fat body promotes antimicrobial responses through the imd pathway upon infection by Gram-negative bacteria. B, C Relative mRNA expression in the fat body before PA14 infection. n = 8 flies/group. Data are shown as mean ± SD and ***p < 0.001 by Student’s t-test. D The survival curve and median survival in flies with fat body-specific C564-driven +, HP1a, imd RNAi, and HP1a; imd RNAi after PA14 infection. n = 40 flies/group. **p < 0.01, ***p < 0.001 by log-rank test. ns, not significant

Full size image

The imd pathway is required for AMP gene expression in response to Gram-negative bacteria. Therefore, we next asked whether increased fat body heterochromatin formation activates the expression of imd-mediated AMPs. We found that, even before infection, increased heterochromatin formation was associated with specific upregulation of several imd-mediated AMPs (Additional file 1: Fig. S8A). Moreover, the HP1a overexpression-induced imd-mediated AMPs, including Attacin A (AttA), Diptericin (DptA), and Drosocin (Dro), were not only upregulated to the greatest extent when heterochromatin was increased in the fat body (Fig. 4A–C, Additional file 1: Fig. S8A) but were also downregulated most significantly by simultaneous knockdown of imd (Fig. 4A–C). Interestingly, we found that HP1a and imd mRNA in the fat body are drastically upregulated in all flies at 27 hpi compared to 15 hpi, while fat body-specific C564-driven + and HP1a groups express higher imd levels than the corresponding groups expressing imdRNAi and HP1a; imdRNAi (Fig. 4D, E, Additional file 1: Fig. S9A, B, F, G). These data suggest that HP1a-mediated heterochromatin formation regulates antimicrobial immune responses via the imd pathway in the Drosophila fat body upon P. aeruginosa infection. Next, we determined whether HP1a-mediated heterochromatin regulates other immune or stress responses such as the Toll and JAK-STAT pathways to activate antibacterial activity. Before infection, the expression of Toll-mediated AMPs in the fat body with increased heterochromatin levels showed that Bomanin 1 (BomS1), Drosomycin (Drs), and Daisho1 (Dso1) are upregulated and that Baramicin (Bara) and Daisho2 (Dso2) are downregulated (Additional file 1: Fig. S8A). These results suggest that HP1a-mediated heterochromatin selectively regulates expression of Toll-mediated AMPs. Moreover, the JAK-STAT response genes including Turandot A (TotA) and STAT92E were not upregulated by increased fat body HP1a-mediated heterochromatin formation, suggesting that HP1a overexpression does not induce a major stress before infection (Additional file 1: Fig. S8B). Additionally, after infection, AttA, DptA, and Dro were all drastically upregulated at 27 hpi, while the HP1a overexpressing animals expressed even higher levels of DptA and Dro than control (Fig. 4F–H, Additional file 1: Fig. S9C-E, H-J). These results indicate that increased heterochromatin formation in the fat body promotes upregulation of imd-mediated AMPs in the middle stage of P. aeruginosa infection.

Fig. 4
figure 4

Increased heterochromatin formation in the fat body promotes imd pathway mediated DptA and Dro overexpression. A–C Relative expression of imd-mediated AMP mRNA in the fat body was measured before PA14 infection. n= 8 flies/group. D–H Relative expression of HP1a, imd, DptA, Dro, and AttA mRNA in the fat body was measured in the early and middle stages of PA14 infection. Note that C564>HP1a flies already showed constitutive upregulation of various AMP as compared to control C564>+ before infection as shown in A–C but the differences are not easily observed in D–H due to the log scale. n=4 flies/group at each time point. Data are shown as mean ± SD and **p < 0.01, ***p < 0.001 by Student’s t-test. ns, not significant

Full size image

Fat body DptA is sufficient and necessary for HP1a-mediated antimicrobial responses against P. aeruginosa infection

To determine whether the AMPs, including AttA, DptA, and Dro, are required for host resistance to P. aeruginosa infection, we examined survival in flies with fat body-specific overexpression or knockdown of these AMPs after infection. Fat body DptA and Dro mRNA were expressed at > 900 and > 15,000 fold, respectively, in C564>DptA and C564>Dro flies compared to controls (Additional file 1: Fig. S10A, B). DptA overexpression in the Drosophila fat body was associated with increased resistance to P. aeruginosa infection and longer survival compared to controls (Fig. 5A). Moreover, knockdown of DptA in the fat body decreased resistance to P. aeruginosa infection after induction by increased fat body HP1a-mediated heterochromatin formation (Fig. 5B). In contrast, Dro overexpression in the fat body alone did not lead to increased resistance to P. aeruginosa infection (Additional file 1: Fig. S10C), suggesting that HP1a-mediated heterochromatin formation-induced Dro upregulation is not sufficient to promote resistance to P. aeruginosa infection. Likewise, AttA was not necessary to promote resistance to P. aeruginosa infection in flies with increased fat body heterochromatin formation (Additional file 1: Fig. S10D). These results suggest that fat body heterochromatin formation-induced DptA upregulation is a key event that is sufficient and necessary to trigger HP1a-mediated antimicrobial responses to P. aeruginosa infection.

Fig. 5
figure 5

Increased DptA expression in the fat body is sufficient and necessary for HP1a-mediated antimicrobial responses against PA14 infection. A The survival curve and median survival in flies with fat body-specific C564-driven + and DptA expression after PA14 infection. B The survival curve and median survival in flies with fat body-specific C564-driven +, HP1a, DptARNAi, and HP1a; DptARNAi expression after PA14 infection. n = 40/group. *p < 0.05, **p < 0.01, ***p < 0.001 by logrank test. ns, not significant

Full size image

Heterochromatin formation in cells of the fat body is required in the middle stage of P. aeruginosa infection

We noticed that HP1a mRNA was upregulated in the middle stage of P. aeruginosa infection (Fig. 4D). To further characterize antimicrobial responses associated with HP1a-mediated heterochromatin formation in cells of the Drosophila fat body, we performed immunostaining to quantify heterochromatin levels in the early and middle stages of P. aeruginosa PA14 infection (Fig. 6A). Heterochromatin levels, indicated via H3K9me2 and HP1a staining, were decreased at 15 hpi compared to levels before infection (Fig. 6B–D). Heterochromatin levels then increased at 27 hpi compared to 15 hpi. These data indicate upregulation of HP1a protein expression, in addition to HP1a mRNA, at 27 hpi compared to 15 hpi. Our data demonstrate that fat body heterochromatin levels are decreased in the early stage and increased in the middle stage of P. aeruginosa infection. These results suggest that time-dependent upregulation of Drosophila fat body heterochromatin formation is required in the middle stage of P. aeruginosa infection.

Fig. 6
figure 6

Fat body heterochromatin levels are downregulated in the early stage but upregulated in the middle stage of P. aeruginosa infection. A Schematic of fly collection at different time points of the early and middle stages of PA14 infection for heterochromatin marker immunostaining. B Representative images of fat body cells from wild type flies with HP1a (red) and H3K9me2 (magenta) immunostaining, and nuclear DNA (blue) staining with Hochest. Scale bar: 10 μm. C, D Immunofluorescence intensity of HP1a (C) and H3K9me2 (D) before infection and at 15, 21, and 27 hpi. All results involved staining of tissue from two flies (n = 15/fly). Data are shown as mean ± SD and *p < 0.05, ***p < 0.001 by Student’s t-test. hpi, hrs post infection; ns, not significant

Full size image

Discussion

Characterization of pathways involved in antimicrobial responses to the highly virulent and MDR bacteria P. aeruginosa is a critical pursuit in infectious disease microbiology. Currently, the epigenetic mechanisms of host antimicrobial responses against P. aeruginosa infection are poorly understood. To address this important area of research, we employed Drosophila, the genetically tractable model organism in which innate immunity was first discovered [44], to determine interactions between P. aeruginosa and the host after surgical wound infection. We found that increased HP1a-mediated heterochromatin formation in the fat body, an immune organ that mediates humoral responses, promoted antimicrobial responses, including host resistance to bacterial infection and reduction of bacteria load (Fig. 7). Furthermore, the imd pathway, a key signaling sequence in response to Gram-negative bacteria, and its downstream AMPs, including DptA, were found to mediate fat body heterochromatin formation-induced antimicrobial responses against P. aeruginosa infection. We also demonstrated that fat body heterochromatin levels are tightly regulated in timing in response to P. aeruginosa infection. Heterochromatin levels decrease in the early stage of infection but then increase in the middle stage. Through our study, we identified a novel epigenetic mechanism in which increased heterochromatin formation in the Drosophila fat body promotes antimicrobial responses against P. aeruginosa infection.

Fig. 7
figure 7

Heterochromatin formation promotes antimicrobial responses through imd pathway mediated expression of AMPs, including DptA. Increased HP1a-mediated heterochromatin formation in the fat body promotes resistance to systemic P. aeruginosa infection. Before infection, fat body HP1a-mediated heterochromatin formation induces overexpression of imd pathwayrelated AMPs. Mechanistically, upon P. aeruginosa infection, increased heterochromatin formation in the fat body promotes antimicrobial responses through imd pathway mediated DptA expression. Moreover, upon P. aeruginosa infection, the time-dependent, physiological heterochromatin levels are tightly regulated via epigenetic changes: downregulated in the early stage of P. aeruginosa infection and then upregulated in the middle stage. Increased fat body heterochromatin formation improves antimicrobial responses against P. aeruginosa infection and promotes host survival

Full size image

AMPs are produced as a first-line defense in most cell types [45,46,47]. AMPs are positively charged, amphipathic peptides that disrupt bacteria through non-specific interactions with the negatively charged bacterial cell membrane [38]. Because of their broad activity, non-specificity, and rapid action, AMPs can limit emergence of bacterial resistance and have been used in many clinical trials [48]. Indeed, overexpression of DptA and AttA provide protection against P. aeruginosa infection in immunocompromised Drosophila [37]. In our study, we found that HP1a-mediated antimicrobial responses to P. aeruginosa infection in Drosophila were dependent on DptA expression, but not on AttA (Fig. 5, Additional file 1: Fig. S10D), suggesting that DptA is a potent antimicrobial agent. It raises our curiosity whether DptA works alone or together with other AMPs to confer specificity, if any, to host resistance against P. aeruginosa infection. To characterize the contribution of DptA and also minimize possible background effects, we performed the P. aeruginosa infection in the DptSK1 (DptA and DptB mutations), ∆AMP+Dpt (AttA-D, Def, Dro, Drs, and Mtk mutations), ∆AMP (combined 10 AMP mutations), and control iso w1118 flies [49]. Interestingly, ∆AMP flies were more vulnerable to PA14 infection (Additional file 1: Fig. S11) [49]. However, DptSK1 and ∆AMP+Dpt flies had similar host susceptibility to PA14 infection compared to control, iso w1118. These results suggest that DptA is not specific for host resistance to P. aeruginosa infection and yet has combinatory contribution with DptB and other 8 AMPs to resist PA14 infection. Moreover, although upregulation of Dro in the fat body is associated with increased HP1a-mediated heterochromatin in the middle stage of P. aeruginosa infection, overexpression of Dro does not increase host survival upon infection (Additional file 1: Fig. S10C). Previous findings have revealed an incredible specificity for DptA in defense against P. rettgeri infection [49, 50]. Similar AMP microbe specificities have been shown for Daisho and Fusarium fungi [51] and a recent study by Hanson et al. shows a Drosocin-derived peptide is specific to P. burhodogranariea [52]. Interestingly, an elegant new study by Shaka et al. also found Drosocin mediates susceptibility to P. alcalifaciens, specifically according to LPS biosynthesis pathways [53]. Consistent with these previous findings, our results indicate that the additive/synergistic combination and specificity of antimicrobial activity shown by different AMPs are important research areas that require further investigation.

Our research demonstrated that increased HP1a-mediated heterochromatin formation in the fat body enhanced host survival after P. aeruginosa infection (Fig. 1B–E, Additional file 1: Fig. S6A, B). To exclude effects of varying genetic background, HP1a was overexpressed through an RU486-inducible system in adult flies for 4 days upon eclosion. The 4-day-old adult flies were subjected to systemic P. aeruginosa infection and then raised with standard food without RU486 (Fig. 1D-F). Surprisingly, increased HP1-mediated heterochromatin formation in the fat body for a limited period of time during adulthood was sufficient to promote later antimicrobial responses to P. aeruginosa infection. These results suggest a potential prophylactic strategy using HP1a-mediated heterochromatin formation to combat P. aeruginosa infection.

P. aeruginosa is a major cause of nosocomial infections, especially in immunocompromised patients. In this study, flies immunocompromised via fat body-specific imd knockdown had reduced survival rates following P. aeruginosa infection compared to WT controls (Fig. 3D). Surprisingly, we found that concurrently increasing fat body heterochromatin formation in flies with imd knockdown was sufficient to rescue host resistance to WT levels (Fig. 3D). Therefore, host survival after P. aeruginosa infection was increased in the immunocompromised flies with concurrent fat body HP1a overexpression, indicating that, even in the immunocompromised flies, increased heterochromatin formation in the fat body can promote antimicrobial immune responses against P. aeruginosa infection. Interestingly, heterochromatin-mediated upregulation of AMPs upon P. aeruginosa infection was dramatically reduced by concurrent knockdown of imd in the fat body (Fig. 4A–C, F–H, Additional file 1: Fig. S8A). Importantly, we have found that HP1a and imd mRNA levels, respectively, were overexpressed and knocked down as efficiently in the C564>HP1a and C564>imdRNAi flies with single UAS transgenes, as in C564>HP1a; imdRNAi flies with two UAS transgenes (Fig. 3B, C), suggesting that C564-driven expression levels of UAS transgenes are not affected by the copy number of UAS transgenes in endomitotic fat body cells [54, 55]. Overall, these results suggest that heterochromatin-mediated antimicrobial responses depend partly on induction of imd-related AMPs, and also that there are likely other important immune pathway components yet to be identified. Together, those factors may be protective, even in an immunocompromised host, against P. aeruginosa infection. Thus, our study highlights a promising new direction for antimicrobial research in which modulation of heterochromatin formation could be used as a strategy for development of new, more effective treatments to prevent or fight P. aeruginosa infection.

We found that increased heterochromatin formation through HP1a overexpression upregulates several imd-mediated AMPs before infection (Additional file 1: Fig. S8A). To clarify the nature of the HP1a-mediated heterochromatin effect on AMPs, we investigated the expression of AMPs in the fat body with HP1a knockdown. Surprisingly, knockdown of HP1a by RNAi in the fat body upregulated imd-mediated AMPs, including AttA, DptA, and Dro (Additional file 1: Fig. S4C-E). Based on our results, heterochromatin levels, indicated via H3K9me2 and HP1a staining, were decreased in the early stage of P. aeruginosa infection (Fig. 6B–D). These results imply that decreased HP1a is required for immune responsive cells of the fat body in the early stage of P. aeruginosa infection to promote upregulation of AMPs genes. However, fat body-driven HP1a knockdown did not significantly affect host resistance against PA14 infection (Additional file 1: Fig. S4A). In contrast, increased HP1a-mediated heterochromatin formation promotes resistance to P. aeruginosa infection with the most notable induction of DptA. We analyzed HP1a binding at the DptA locus using chromatin immunoprecipitation (ChIP)-qPCR and found that ubiquitous HP1a overexpression increased HP1a binding at the DptA locus (Additional file 1: Fig. S12) [56]. Interestingly, several studies have showed that increased HP1a is associated with upregulation of euchromatic genes [57,58,59] and with increases of RNA polymerase pausing [60]. Together, these findings suggest that increased HP1a-mediated heterochromatin formation participates in imd-mediated DptA induction. Our study provides multifaceted epigenetic insights regarding HP1a-mediated antimicrobial responses during the different stage of infection.

Conclusions

Pseudomonas aeruginosa is a common opportunistic pathogen associated with severe hospital-acquired infection and mortality. Effective therapeutic options for P. aeruginosa infection are limited due to increasing multidrug resistance. We found that increased formation of HP1a-mediated heterochromatin, an essential but poorly understood part of epigenome, promotes host survival and resistance to P. aeruginosa infection in Drosophila. Timely upregulation of heterochromatin formation in the fat body, a Drosophila immune organ, further increased expression of imd pathway-mediated antimicrobial peptides, with the most notable induction of Diptericin A, which is critical for HP1a-mediated antimicrobial response. Our study has identified a novel epigenetic mechanism of host immune response via heterochromatin formation, and our report highlights new therapeutic strategies to fight P. aeruginosa infection through heterochromatin targeting.

Methods

Fly strains

All fly strains were reared at 25 °C on standard yeast-based fly food, at 65% humidity, and on a 12-hour light/dark cycle. The Oregon-R, w1118, HP1a04, C564-Gal4, and S106-gene switch-Gal4 lines were provided by the Bloomington Drosophila stock center (Bloomington, IN, USA). The UAS-HP1aRNAi (31995), UAS-HP1aRNAi (31994), UAS-imdRNAi (9253), and UAS-DptARNAi (41284) lines were provided by the Vienna Drosophila RNAi Center (Vienna, Austria). The UAS-DptA (109923) line was provided by the Drosophila Genomics Resource Center (Bloomington, IN, USA). hs-HP1a flies were generous gifts from Dr. Lori Wallrath (University of Iowa, IA, USA) and Dr. Gunter Reuter (Martin Luther University Halle, Halle, Germany). UAS-HP1a flies were kind gifts from Dr. Willis Li (University of California San Diego, CA, USA). Lsp2-Gal4 flies were a kind gift from Dr. Guang-Chao Chen (Academia Sinica, Taiwan). UAS-Dro, UAS-AttARNAi, iso w1118, DptSK1, ∆AMP+Dpt, and ∆AMP flies were kind gifts from Dr. Mark Hanson and Dr. Bruno Lemaitre (École Polytechnique Fédérale de Lausanne, Switzerland). The UAS-HP1a; UAS-imdRNAi, UAS-HP1a; UAS-DptARNAi, and UAS-HP1a; UAS-AttARNAi lines were constructed by chromosome recombination.

For bacterial infection experiments, unless otherwise specified, progeny from male w1118 flies crossed with females with the transgenic fat body-specific Gal4 driver were used as wild-type control. Progeny from UAS transgene male flies, as listed above, crossed with female flies with the transgenic fat body-specific Gal4 driver were used as the experimental group.

Bacterial infection

Pseudomonas aeruginosa PA14 was stored as frozen stocks (in 50% glycerol) at – 80 °C. The bacterium was kindly gifted from Dr. Chang-Shi Chen (National Cheng Kung University, Taiwan). Before inoculation, the bacterial glycerol stock was streaked onto the LB agar plates and incubated overnight (~15 h.) at 37°C. A single bacterial colony was selected from the cultured plates and then used to inoculate 5 mL LB broth in a sterile tube. After incubation at 37°C, with shaking (250 rpm), overnight, the culture was diluted in 5 mL fresh LB media to reach OD600 = 0.03 and then subjected to further incubation at 37°C, with shaking at 250 rpm, until its optical density at 600 nm reached 1.6. Finally, the bacterial density was adjusted to a suitable concentration (OD600 = 0.1, about 108 cells/ml, OD600 = 0.01, or OD600 = 0.001) for use in inoculation throughout the study, unless otherwise specified. Inoculation was achieved by pricking the thorax of a 3–5 day old male fly with a tungsten needle (25 gauge) that had been dipped into an inoculum [61]. Infected flies were incubated in vials (10 flies/vial) at 22 °C, at 60% humidity, on a 12-h light/dark cycle. The LINKO LKU-6000 spectrophotometer was used to quantify bacterial concentration at 600 nm. Survival rate after bacterial infection was determined by counting live flies every 3 h.

Bacterial quantification

Flies were homogenized in 200 μl phosphate-buffered saline (PBS) and homogenates were diluted (× 10) appropriately and then plated on LB agar plates. Colony-forming units (CFU) were counted as a measure of bacterial load in the flies.

Gene switch inducible system

To induce the expression of specific genes, adult flies were provided food containing 600 μM RU486 and EtOH (control) at 0 day old. After 4 days, flies were inoculated with bacteria.

qRT-PCR

Fat body tissues from four flies were collected at DNA/RNA Shieldâ„¢ (ZYMO RESEARCH, USA) and mRNA was extracted using Quick-RNAâ„¢ Microprep Kit (ZYMO RESEARCH, USA). cDNA synthesis was performed using the PrimeScript RT reagent Kit (TaKaRa, Japan). RT-PCR was performed in triplicate for each sample using SYBR Green PCR Master Mix (Applied Biosystems, USA) on the Thermo Fisher Scientific StepOne system. Relative levels of target gene mRNA were normalized to the reference gene rpl32. The following primers were used:

Gene

Forward (5′->3′)

Reverse (5′->3′)

rpl32

GCTAAGCTGTCGCACAAATG

GTTCGATCCGTAACCGATGT

HP1a

CGCAAGGATGAGGAGAAGTCA

TCCTGAAACGGGAATGGTGTC

imd

GGCATGTCGGAAGGACAGAT

GCTGTTTGTCTTGCGCTTCT

DptA

GCTGCGCAATCGCTTCTACT

TGGTGGAGTGGGCTTCATG

Dro

CCACCACTCCAAGCACAATGAA

CATCTTTAGGCGGGCAGAATGG

AttA

CTCCTGCTGGAAAACATC

GCTCGTTTGGATCTGACC

AttB

GGGTAATATTTAACCGAAGT

GTGCTAATCTCTGGTCATC

AttC

CTGCACTGGACTACTCCCACATCA

CGATCCTGCGACTGCCAAAGATTG

Bara

GGTGAGCATGTGTACACCGA

GGCGGAAAAATTGGGACCAC

BomS1

GCCAATGCTGTTCCACTGTC

GGGTTGAAACTTCCTACTTGCC

CecA1

ATCAGTCGCTCAGACCTCAC

GATTGTGGCATCCCGAGTGT

CecC

CAATCGGAAGCCGGTTGGCTG

GCGCAATTCCCAGTCCTTGAATGG

Def

GTTCTTCGTTCTCGTGG

CTTTGAACCCCTTGGC

Drs

CGTGAGAACCTTTTCCAATATGATG

TCCCAGGACCACCAGCAT

Dso1

AACCTGGAACCGTGCTCATC

GGCAAATGTCAAATGTTGGGTC

Dso2

CTTCGCTCTGATTGCGGCTT

AATCAACGTGTGTCCGCCA

Mtk

AACTTAATCTTGGAGCGA

CGGTCTTGGTTGGTTAG

TotA

CCCTGAGGAACGGGAGAGTA

CTTTCCAACGATCCTCGCCT

STAT92E

CTGGGCATTCACAACAATCCAC

GTATTGCGCGTAACGAACCG

Immunostaining

Adult fat bodies with attached dorsal cuticles were dissected from the fly abdomen in PBS. The fat body tissues were fixed with 4% paraformaldehyde in PBS for 15 min at RT followed by washing three times for 10 min with PBST (PBS containing 0.1% Triton X-100). The fat body from each fly was incubated with primary antibodies in PBST with normal goat serum (NGS) at 4 °C for 48 h. The tissues were incubated with primary antibodies, including mouse monoclonal anti-HP1a (C1A9, 1:300; Developmental Studies Hybridoma Bank) and/or rabbit anti-H3K9me2 (07-212, 1:500; Upstate Biotechnology) in PBST with NGS. After washing three times in PBST for 10 min, each tissue was incubated with secondary antibodies and DNA staining dye (Hoechst, 1:1000; Invitrogen) at 4 °C for 24 h. The tissues were incubated with secondary antibodies, including goat anti-mouse conjugated to Alexa Fluor-594 (Thermo Fisher Scientific, USA) and/or goat anti-rabbit conjugated to Alexa Fluor-647 (Thermo Fisher Scientific) in PBST with NGS. Tissues were then washed 3 times in the PBST for 10 min, and the fat body tissues were then dissected in PBST and mounted on slides with VECTASHIELD® antifade mounting medium (Vector Laboratories, USA). Images were captured using a confocal microscope (Carl Zeiss LSM780, Core Facility Center, National Cheng Kung University, Tainan, Taiwan).

Chromatin immunoprecipitation

For ChIP experiments, 120 male flies were collected to enable ChIP using Magna ChIP™ HiSens Kit (Merck Millipore, USA). The flies were fixed with 0.5% formaldehyde for 10 min at RT. The crosslinked chromatin was stopped by glycine and washing with ice cold PBS buffer. The tissue lysate was then sonicated to shear DNA into ~200-1000 bp using sonicator (LINKO Ultrasonic processor UP-300). Sheared crosslinked chromatin was incubated with 2.5 μl HP1a antibody (C1A9; Developmental Studies Hybridoma Bank) or 2.5 μg control IgG (#5415; Cell Signaling) at 4 °C overnight. RT-PCR was performed in triplicate for each sample using SYBR Green PCR Master Mix (Applied Biosystems, USA) on the Thermo Fisher Scientific StepOne system. The following ChIP primers for qPCR were used:

Gene

Forward (5′->3′)

Reverse (5′->3′)

cdc2

CCATATGTGCCCTCGCCAAT

GTAGCTAGCTTAGCATCGTT

rp49

GTAAACGCGGTTCTGCATGAGC

ATCGGTTACGGATCGAACAAGC

DptA-1

ATGAGACAATAACCGCCGTAGG

CAAAGTAAGGCGACGGCAAT

DptA-2

CATTGCCGTCGCCTTACTTT

TTCAGTCCAATCTCGTGGCG

DptA-3

ACAATGGACGCCACGAGATT

AGCTAGACTCGGATACCAATCG

DptA-4

AAGTGGGAAGCACCTACACCT

GTTCCGGGTTAAACAAACAACGC

Statistical analysis

All data were analyzed and presented using PRISM 6 (GraphPad, San Diego, CA). Statistical analyses were performed using Student's t-test and reported as mean ± SD, as specified in the respective figure legends. Significance levels are indicated as p-values below 0.05. All survival data were analyzed using the Log-rank (Mantel-Cox) test.

Availability of data and materials

All data generated or analyzed during this study are included in this published article and its supplementary information files.

References

  1. Wu W, Jin Y, Bai F, Jin S. Chapter 41 Pseudomonas aeruginosa. Mol Med Microbiol. 2015:753–67. https://doi.org/10.1016/B978-0-12-397169-2.00041-X.

  2. Bălăşoiu M, Bălăşoiu A, Mănescu R, Avramescu C, Ionete O. Pseudomonas aeruginosa resistance phenotypes and phenotypic highlighting methods. Curr Health Sci J. 2014;40(2):85–92.

    PubMed  PubMed Central  Google Scholar 

  3. Chatterjee M, Anju CP, Biswas L, Anil Kumar V, Gopi Mohan C, Biswas R. Antibiotic resistance in Pseudomonas aeruginosa and alternative therapeutic options. Int J Med Microbiol. 2016;306(1):48–58.

    Article  CAS  PubMed  Google Scholar 

  4. Migiyama Y, Yanagihara K, Kaku N, Harada Y, Yamada K, Nagaoka K, et al. Pseudomonas aeruginosa bacteremia among immunocompetent and immunocompromised patients: relation to initial antibiotic therapy and survival. Jpn J Infect Dis. 2016;69(2):91–6.

    Article  CAS  PubMed  Google Scholar 

  5. Driscoll JA, Brody SL, Kollef MH. The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections. Drugs. 2007;67(3):351–68.

    Article  CAS  PubMed  Google Scholar 

  6. Williams BJ, Dehnbostel J, Blackwell TS. Pseudomonas aeruginosa: host defence in lung diseases. Respirology. 2010;15(7):1037–56.

    Article  PubMed  Google Scholar 

  7. Sainz-Mejías M, Jurado-Martín I, McClean S. Understanding pseudomonas aeruginosa–host interactions: the ongoing quest for an efficacious vaccine. Cells. 2020;9(12):2617.

    Article  PubMed Central  Google Scholar 

  8. Zhang L-J, Gallo RL. Antimicrobial peptides. Curr Biol. 2016;26(1):R14–9.

    Article  CAS  PubMed  Google Scholar 

  9. Geitani R, Moubareck CA, Xu Z, Karam Sarkis D, Touqui L. Expression and roles of antimicrobial peptides in innate defense of airway mucosa: potential implication in cystic fibrosis. Front Immunol. 2020;11. https://doi.org/10.3389/fimmu.2020.01198.

  10. Mwangi J, Yin Y, Wang G, Yang M, Li Y, Zhang Z, et al. The antimicrobial peptide ZY4 combats multidrug-resistant Pseudomonas aeruginosa and Acinetobacter baumannii infection. Proc Natl Acad Sci U S A. 2019;116(52):26516–22.

    Article  CAS  PubMed Central  Google Scholar 

  11. Huan Y, Kong Q, Mou H, Yi H. Antimicrobial peptides: classification, design, application and research progress in multiple fields. Front Microbiol. 2020;11. https://doi.org/10.3389/fmicb.2020.582779.

  12. Lavoie EG, Wangdi T, Kazmierczak BI. Innate immune responses to Pseudomonas aeruginosa infection. Microbes Infect. 2011;13(14-15):1133–45.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Buchon N, Silverman N, Cherry S. Immunity in Drosophila melanogaster--from microbial recognition to whole-organism physiology. Nat Rev Immunol. 2014;14(12):796–810.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Smale ST, Tarakhovsky A, Natoli G. Chromatin contributions to the regulation of innate immunity. Annu Rev Immunol. 2014;32:489–511.

    Article  CAS  PubMed  Google Scholar 

  15. Perkins DJ, Patel MC, Blanco JC, Vogel SN. Epigenetic mechanisms governing innate inflammatory responses. J Interf Cytokine Res. 2016;36(7):454–61.

    Article  CAS  Google Scholar 

  16. Jenuwein T, Allis CD. Translating the histone code. Science. 2001;293(5532):1074–80.

    Article  CAS  PubMed  Google Scholar 

  17. Grewal SIS, Jia S. Heterochromatin revisited. Nat Rev Genet. 2007;8(1):35–46.

    Article  CAS  PubMed  Google Scholar 

  18. Bannister AJ, Kouzarides T. Regulation of chromatin by histone modifications. Cell Res. 2011;21(3):381–95.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Jacobs SA, Taverna SD, Zhang Y, Briggs SD, Li J, Eissenberg JC, et al. Specificity of the HP1 chromo domain for the methylated N-terminus of histone H3. EMBO J. 2001;20(18):5232–41.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Nakayama J-i, Rice JC, Strahl BD, Allis CD, Grewal SIS. Role of histone H3 lysine 9 methylation in epigenetic control of heterochromatin assembly. Science. 2001;292(5514):110–3.

    Article  CAS  PubMed  Google Scholar 

  21. Lachner M, O'Carroll D, Rea S, Mechtler K, Jenuwein T. Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature. 2001;410(6824):116–20.

    Article  CAS  PubMed  Google Scholar 

  22. Bannister AJ, Zegerman P, Partridge JF, Miska EA, Thomas JO, Allshire RC, et al. Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature. 2001;410(6824):120–4.

    Article  CAS  PubMed  Google Scholar 

  23. Chang C-W, Shen Y-C, Yan S-J. HP1a-mediated heterochromatin formation inhibits high dietary sugar-induced tumor progression. Cell Death Dis. 2021;12(12):1130.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Kilic S, Felekyan S, Doroshenko O, Boichenko I, Dimura M, Vardanyan H, et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nat Commun. 2018;9(1). https://doi.org/10.1038/s41467-017-02619-5.

  25. Machida S, Takizawa Y, Ishimaru M, Sugita Y, Sekine S, Nakayama J-I, et al. Structural basis of heterochromatin formation by human HP1. Mol Cell. 2018;69(3):385–397.e388.

    Article  CAS  PubMed  Google Scholar 

  26. Canzio D, Liao M, Naber N, Pate E, Larson A, Wu S, et al. A conformational switch in HP1 releases auto-inhibition to drive heterochromatin assembly. Nature. 2013;496(7445):377–81.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Vermaak D, Malik HS. Multiple roles for heterochromatin protein 1 genes in Drosophila. Annu Rev Genet. 2009;43(1):467–92.

    Article  CAS  PubMed  Google Scholar 

  28. Hardbower DM, Asim M, Luis PB, Singh K, Barry DP, Yang C, et al. Ornithine decarboxylase regulates M1 macrophage activation and mucosal inflammation via histone modifications. Proc Natl Acad Sci. 2017;114(5):E751.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Segura-Bayona S, Villamor-Payà M, Attolini CS, Koenig LM, Sanchiz-Calvo M, Boulton SJ, et al. Tousled-like kinases suppress innate immune signaling triggered by alternative lengthening of telomeres. Cell Rep. 2020;32(5):107983.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Saccani S, Natoli G. Dynamic changes in histone H3 Lys 9 methylation occurring at tightly regulated inducible inflammatory genes. Genes Dev. 2002;16(17):2219–24.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Yoshida K, Maekawa T, Zhu Y, Renard-Guillet C, Chatton B, Inoue K, et al. The transcription factor ATF7 mediates lipopolysaccharide-induced epigenetic changes in macrophages involved in innate immunological memory. Nat Immunol. 2015;16(10):1034–43.

    Article  CAS  PubMed  Google Scholar 

  32. Jin J, Xie X, Xiao Y, Hu H, Zou Q, Cheng X, et al. Epigenetic regulation of the expression of Il12 and Il23 and autoimmune inflammation by the deubiquitinase Trabid. Nat Immunol. 2016;17(3):259–68.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Lemaitre B, Hoffmann J. The host defense of Drosophila melanogaster. Annu Rev Immunol. 2007;25:697–743.

    Article  CAS  PubMed  Google Scholar 

  34. Kounatidis I, Ligoxygakis P. Drosophila as a model system to unravel the layers of innate immunity to infection. Open Biol. 2012;2(5):120075.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Limmer S, Haller S, Drenkard E, Lee J, Yu S, Kocks C, et al. Pseudomonas aeruginosa RhlR is required to neutralize the cellular immune response in a Drosophila melanogaster oral infection model. Proc Natl Acad Sci U S A. 2011;108(42):17378–83.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Apidianakis Y, Mindrinos MN, Xiao W, Lau GW, Baldini RL, Davis RW, et al. Profiling early infection responses: Pseudomonas aeruginosa eludes host defenses by suppressing antimicrobial peptide gene expression. Proc Natl Acad Sci U S A. 2005;102(7):2573–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Tzou P, Reichhart JM, Lemaitre B. Constitutive expression of a single antimicrobial peptide can restore wild-type resistance to infection in immunodeficient Drosophila mutants. Proc Natl Acad Sci U S A. 2002;99(4):2152–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Hanson MA, Lemaitre B. New insights on Drosophila antimicrobial peptide function in host defense and beyond. Curr Opin Immunol. 2020;62:22–30.

    Article  CAS  PubMed  Google Scholar 

  39. Larson K, Yan SJ, Tsurumi A, Liu J, Zhou J, Gaur K, et al. Heterochromatin formation promotes longevity and represses ribosomal RNA synthesis. PLoS Genet. 2012;8(1):e1002473.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Eissenberg JC, Morris GD, Reuter G, Hartnett T. The heterochromatin-associated protein HP-1 is an essential protein in Drosophila with dosage-dependent effects on position-effect variegation. Genetics. 1992;131(2):345–52.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Zaidman-Rémy A, Hervé M, Poidevin M, Pili-Floury S, Kim M-S, Blanot D, et al. The Drosophila amidase PGRP-LB modulates the immune response to bacterial infection. Immunity. 2006;24(4):463–73.

    Article  PubMed  Google Scholar 

  42. Roman G, Endo K, Zong L, Davis RL. P[Switch], a system for spatial and temporal control of gene expression in Drosophila melanogaster. Proc Natl Acad Sci U S A. 2001;98(22):12602–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Takeuchi T, Suzuki M, Fujikake N, Popiel HA, Kikuchi H, Futaki S, et al. Intercellular chaperone transmission via exosomes contributes to maintenance of protein homeostasis at the organismal level. Proc Natl Acad Sci. 2015;112(19):E2497–506.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Imler J-L. Overview of Drosophila immunity: a historical perspective. Dev Comp Immunol. 2014;42(1):3–15.

    Article  CAS  PubMed  Google Scholar 

  45. Gallo RL, Hooper LV. Epithelial antimicrobial defence of the skin and intestine. Nat Rev Immunol. 2012;12(7):503–16.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  46. Silva NC, Sarmento B, Pintado M. The importance of antimicrobial peptides and their potential for therapeutic use in ophthalmology. Int J Antimicrob Agents. 2013;41(1):5–10.

    Article  CAS  PubMed  Google Scholar 

  47. Hiemstra PS, Amatngalim GD, van der Does AM, Taube C. Antimicrobial peptides and innate lung defenses: role in infectious and noninfectious lung diseases and therapeutic applications. Chest. 2016;149(2):545–51.

    Article  PubMed  Google Scholar 

  48. Dijksteel GS, Ulrich MMW, Middelkoop E, Boekema BKHL. Review: Lessons learned from clinical trials using antimicrobial peptides (AMPs). Front Microbiol. 2021;12. https://doi.org/10.3389/fmicb.2021.616979.

  49. Hanson MA, Dostálová A, Ceroni C, Poidevin M, Kondo S, Lemaitre B. Synergy and remarkable specificity of antimicrobial peptides in vivo using a systematic knockout approach. eLife. 2019;8:e44341.

    Article  PubMed  PubMed Central  Google Scholar 

  50. Unckless RL, Howick VM, Lazzaro BP. Convergent balancing selection on an antimicrobial peptide in Drosophila. Curr Biol. 2016;26(2):257–62.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Cohen LB, Lindsay SA, Xu Y, Lin SJH, Wasserman SA. The Daisho peptides mediate Drosophila defense against a subset of filamentous fungi. Front Immunol. 2020;11:9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  52. Hanson MA, Kondo S, Lemaitre B. Drosophila immunity: the Drosocin gene encodes two host defence peptides with pathogen-specific roles. Proc Biol Sci. 1977;2022(289):20220773.

    Google Scholar 

  53. Shaka M, Arias-Rojas A, Hrdina A, Frahm D, Iatsenko I. Lipopolysaccharide -mediated resistance to host antimicrobial peptides and hemocyte-derived reactive-oxygen species are the major Providencia alcalifaciens virulence factors in Drosophila melanogaster. PLoS Pathog. 2022;18(9):e1010825.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Guarner A, Morris R, Korenjak M, Boukhali M, Zappia MP, Van Rechem C, et al. E2F/DP prevents cell-cycle progression in endocycling fat body cells by suppressing dATM expression. Dev Cell. 2017;43(6):689–703.e685.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  55. Sher N, Von Stetina JR, Bell GW, Matsuura S, Ravid K, Orr-Weaver TL. Fundamental differences in endoreplication in mammals and <i>Drosophila</i> revealed by analysis of endocycling and endomitotic cells. Proc Natl Acad Sci. 2013;110(23):9368–73.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  56. Hines KA, Cryderman DE, Flannery KM, Yang H, Vitalini MW, Hazelrigg T, et al. Domains of heterochromatin protein 1 required for Drosophila melanogaster heterochromatin spreading. Genetics. 2009;182(4):967–77.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  57. Piacentini L, Fanti L, Berloco M, Perrini B, Pimpinelli S. Heterochromatin protein 1 (HP1) is associated with induced gene expression in Drosophila euchromatin. J Cell Biol. 2003;161(4):707–14.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  58. Cryderman DE, Grade SK, Li Y, Fanti L, Pimpinelli S, Wallrath LL. Role of Drosophila HP1 in euchromatic gene expression. Dev Dyn. 2005;232(3):767–74.

    Article  CAS  PubMed  Google Scholar 

  59. Piacentini L, Fanti L, Negri R, Del Vescovo V, Fatica A, Altieri F, et al. Heterochromatin protein 1 (HP1a) positively regulates euchromatic gene expression through RNA transcript association and interaction with hnRNPs in Drosophila. PLoS Genet. 2009;5(10):e1000670.

    Article  PubMed  PubMed Central  Google Scholar 

  60. Schoelz JM, Feng JX, Riddle NC. The Drosophila HP1 family is associated with active gene expression across chromatin contexts. Genetics. 2021;219(1). https://doi.org/10.1093/genetics/iyab108.

  61. Apidianakis Y, Rahme LG. Drosophila melanogaster as a model host for studying Pseudomonas aeruginosa infection. Nat Protoc. 2009;4(9):1285–94.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank the fruit fly community, Bloomington Drosophila Stock Center, Vienna Drosophila Resource Center, Drosophila Genomics Resource Center, Developmental Studies Hybridoma Bank, and Fly Core in Taiwan for fly lines/antibodies. We thank Dr. Bruno Lemaitre who kindly provides fly lines. We are grateful for support from the Core Research Laboratory, College of Medicine, National Cheng Kung University. We gratefully acknowledge the Core Facility Center of National Cheng Kung University for technical support. We also thank Loretta Collins of WriteScience, LLC for scientific editing and proofreading.

Funding

This work was supported by grants MOST 103-2320-B-006-022-MY3, 106-2320-B-006-041, 108-2320-B-006-033-MY3, and 111-2320-B-006-021-MY3 from the Ministry of Science and Technology (MOST) and National Science and Technology Council (NSTC).

Author information

Authors and Affiliations

  1. Institute of Basic Medical Sciences, College of Medicine, National Cheng-Kung University, No. 1, University Road, Tainan City, Taiwan

    Po-Jen Wu & Shian-Jang Yan

  2. Department of Physiology, College of Medicine, National Cheng-Kung University, No. 1, University Road, Tainan City, Taiwan

    Po-Jen Wu & Shian-Jang Yan

Authors
  1. Po-Jen Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Shian-Jang Yan
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

P.-J.W. and S.-J.Y. designed the research; P.-J.W. performed the research; P.-J.W. analyzed the data; and P.-J.W. and S.-J.Y. wrote the paper. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Shian-Jang Yan.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Figure S1.

HP1a-mediated heterochromatin formation is imperative to regulate resistance to systemic P. aeruginosa infection in Drosophila. Figure S2. Other independent experiments also show that increased HP1a-mediated heterochromatin formation in the fat body promotes resistance against systemic P. aeruginosa PA14 infection, related to Fig. 1. Figure S3. Increased fat body HP1a-mediated heterochromatin promotes host resistance to PA14 infection with a lower bacterial dose. Figure S4. HP1a knockdown in the fat body does not affect survival after systemic P. aeruginosa infection. Figure S5. RU486 induces fat body-specific S106-Gene Switch-driven gene expression, as demonstrated by GFP expression. Figure S6. Increased heterochromatin formation in the fat body promotes survival and host resistance to P. aeruginosa PA14 infection. Figure S7. CFU measurements from fat body-driven HP1a and control flies after P. aeruginosa PA14 infection. Figure S8. Increased heterochromatin formation upregulates a broad spectrum of AMPs, and upregulation of AttA, DptA, and Dro is heavily dependent on the imd pathway. Figure S9. Increased heterochromatin formation in the fat body promotes upregulation of imd-mediated AMPs in the middle stage of P. aeruginosa infection. Figure S10. Validation and effects of AMP gene expression in the fat body. Figure S11.DptA and other AMPs, in combination, are required for host resistance to PA14 infection. Figure S12. Increased HP1a-mediated heterochromatin formation leads to more HP1a binding at the DptA locus.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wu, PJ., Yan, SJ. HP1a-mediated heterochromatin formation promotes antimicrobial responses against Pseudomonas aeruginosa infection. BMC Biol 20, 234 (2022). https://doi.org/10.1186/s12915-022-01435-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12915-022-01435-8

Keywords

BMC Biology

ISSN: 1741-7007

Contact us