Alternative pre-mRNA processing regulates cell-type specific expression of the IL4l1 and NUP62 genes
- Stefan Wiemann†1Email author,
- Anja Kolb-Kokocinski†1 and
- Annemarie Poustka1
https://doi.org/10.1186/1741-7007-3-16
© Wiemann et al; licensee BioMed Central Ltd. 2005
Received: 08 March 2005
Accepted: 19 July 2005
Published: 19 July 2005
Abstract
Background
Given the complexity of higher organisms, the number of genes encoded by their genomes is surprisingly small. Tissue specific regulation of expression and splicing are major factors enhancing the number of the encoded products. Commonly these mechanisms are intragenic and affect only one gene.
Results
Here we provide evidence that the IL4I1 gene is specifically transcribed from the apparent promoter of the upstream NUP62 gene, and that the first two exons of NUP62 are also contained in the novel IL4I1_2 variant. While expression of IL4I1 driven from its previously described promoter is found mostly in B cells, the expression driven by the NUP62 promoter is restricted to cells in testis (Sertoli cells) and in the brain (e.g., Purkinje cells). Since NUP62 is itself ubiquitously expressed, the IL4I1_2 variant likely derives from cell type specific alternative pre-mRNA processing.
Conclusion
Comparative genomics suggest that the promoter upstream of the NUP62 gene originally belonged to the IL4I1 gene and was later acquired by NUP62 via insertion of a retroposon. Since both genes are apparently essential, the promoter had to serve two genes afterwards. Expression of the IL4I1 gene from the "NUP62" promoter and the tissue specific involvement of the pre-mRNA processing machinery to regulate expression of two unrelated proteins indicate a novel mechanism of gene regulation.
Keywords
Background
Many mechanisms for the alternative use of promoters, exons and polyadenylation signals within genes are known to significantly contribute to the complexity of the transcriptome [1–6]. These variations increase the number of products that can be generated from the currently recognized 20,000 – 30,000 protein-coding genes of the human genome [7]. For example, alternative promoters are used to confer specificity of mRNA expression in time and space [8, 9] and of mRNA translation [10]. Often the N-terminal ends of proteins are altered to generate or remove signal sequences for protein localization [11]. Central exons may or may not be present thus changing the peptide sequence and properties [12]. The alternative use of polyA signals also has effects, for instance, on RNA stability [13, 14].
The mechanisms described above all have in common the fact that the elements involved are associated only with the gene being transcribed and not with any other gene. The mechanism of trans-splicing, in which elements from more than one gene are involved in the generation of transcripts, is an open matter of discussion, although it appears to be rare and its function is still not well understood [15]. Overlapping genes and transcripts have been described in many species and occur in several varieties [16–18]. However, in vertebrates, few transcripts have been described which join two genes with different reading frames [19]. We have found evidence for sequence overlap of transcripts from two protein coding genes, NUP62 and IL4I1, where the latter is expressed in a tissue and cell-type specific manner. Both genes are transcribed from the same promoter and share the first two exons. A similar process has been described for Caenorhabditis elegans [20], in which mRNAs of two cholinergic proteins are transcribed from one promoter. Until now, this principle did not appear to be conserved in higher eukaryotes. The NUP62/IL4I1 genes are therefore the first proof that this mechanism is present in vertebrates. However, in contrast to what has been observed in C. elegans, the functions of the two proteins encoded by the one promoter are completely unrelated.
The protein encoded by NUP62 belongs to the class of nucleoporins (Nups) and is an essential part of the nuclear pore complex [21, 22]. Its N terminus is believed to be involved in nucleocytoplasmic transport, while the C-terminal end contains a coiled-coil structure aiding in protein-protein interactions, and may function in anchorage of the protein in the pore complex (Annotation for P37198 in Swiss-Prot [23]). Nup62, like the other Nups, is conserved in the eukaryote kingdom [24, 25]. The NUP62 gene consists of a single promoter with a CpG island and three transcribed exons. The protein is encoded exclusively by the terminal exon; the first two exons are non-coding. The second exon is prone to alternative splicing and is not contained in about half of the reported cDNAs derived from that gene (e.g., IMAGE:3050260 [26] and DKFZp547L134 [27]). NUP62 is ubiquitously expressed, an observation compatible with its essential role in transporting cargo across the nuclear envelope.
IL4I1 was initially identified to be exclusively expressed in B lymphoblasts as a gene that was induced by treatment with interleukin 4 (IL-4) [28, 29]. Since then, the encoded protein has been identified as a leukocyte specific L-amino acid oxidase (LAAO; [30]) that specifically oxidizes aromatic amino acids. The protein contains an N-terminal signal peptide, which targets the protein to the endoplasmic reticulum and presumably to the lysosomes [30], where it is believed to be involved in antigen processing in B cells [30] and thus act in the immune response. The gene is reported to be transcribed from a single promoter, which appears to restrict expression to cells of the immune system, mostly in B lymphocytes [31]. It consists of eight exons, and the translation start is located in the second exon. The gene is conserved in eutherian mammals (NCBI HomoloGene:22567), but has not been identified in other eukaryotes and in prokaryotes.
We have identified several expressed sequence tags (ESTs) that indicate expression of IL4I1 in tissues other than B lymphocytes, namely human and mouse testis and brain. This expression of the IL4I1 gene was apparently driven by the same promoter as the upstream NUP62 gene. We have verified expression of the Il4i1_2 variant in mouse testis and brain, and thus show that the previously reported NUP62 promoter also drives expression of a second gene in a cell-type and tissue specific manner. The mRNA consists of sequence from both genes and two joining exons which are not part of either previously reported gene locus. Our findings indicate a new mechanism of gene regulation in which two genes that encode unrelated proteins share the same promoter but yet are still expressed in radically different cellular patterns. This suggests that the nature of the transcripts and proteins encoded by these two genes is controlled by tissue specific regulation of pre-mRNA processing.
Results
The exon structure of variant IL4I1_2 joins the described NUP62 and IL4I1genes
Structure of the human NUP62 and IL4I1 genes at chromosomal band 19q13.33. Genes are both shown from 5' (left) to 3' (right). Exons are represented by vertical bars and boxes, intronic sequence by horizontal lines. The NUP62 gene (three exons) is located upstream and tail-to-head to the previously reported IL4I1 gene (eight exons). NUP62 has two splice variants represented by cDNAs IMAGE:3050260 (includes exon 2), and DKFZp547L134 (skipped exon 2). The Nup62 protein is encoded by exon 3 (blue box). IL4I1 does not have reported splice variants and is represented by the sequence AF293462. Translation start of the protein is located in exon 2 (blue bars represent coding region). Several cDNAs were identified to link NUP62 and IL4I1 transcripts (representative: IMAGE:5742307). The splice form consists of the first two apparent exons of the NUP62 gene, two joining exons mapping in between the reported NUP62 and IL4I1 gene loci (red arrow heads), and exons 3–8 of the known IL4I1 gene. Translation start of the protein is in the second joining exon. The sequences of the joining exons are conserved in eutherian species, but not for instance in chicken or fish (taken from UCSC genome browser [54]). The reported promoter of the NUP62 gene contains a CpG island, while the promoter of previously known IL4I1 does not. The two genes cover 40 kb on the chromosome.
The terminal and coding exon from the NUP62 gene is not contained in the IL4I1_2 variant (Fig. 1). While the initiator ATG of the reported IL4I1 ORF is located in exon 2, the first two exons of the known IL4I1 gene are absent in the variant. Instead, the variant contains two additional exons (indicated with red arrowheads in Fig. 1) that are located in the region between the previously reported NUP62 and IL4I1 loci. The latter of the two exons contains the assumed translation initiator ATG.
The IL4I1_2variant is conserved in eutherian mammals
Alignment of sequences upstream the IL4I1 and variant IL4I1_2 open reading frames. Alignments of IL4I1 (upper panel) and variant IL4I1_2 (lower panel) sequences are shown. The first two exons of IL4I1 are shown, and splice sites are underlined and in bold. Ten nucleotides of the next intron are displayed downstream of the first coding exon, which all match the consensus splice donor sequence. Reading frames are in all caps, and the deduced peptide sequences are given below. The human and chimpanzee sequences of IL4I1_2 have an upstream and in-frame start codon (bold), which is not conserved in mouse, rat or dog, and which does not match the Kozak consensus rules. All IL4I1_2 sequences have a short upstream ORF (all caps) which is conserved in location and sequence. The mouse, rat and human sequences were derived from cDNA sequences, while the chimpanzee and dog sequences were deduced from an alignment of human cDNA with the respective genome sequences [54].
All transcripts analyzed had a short six (dog: seven) residue upstream ORF, the localization and sequence of which was conserved. It remains to be determined whether this ORF is expressed in vivo as has been shown for other genes [35]. This ORF is too small and too close to the initiator ATG of the IL4I1-ORF to suggest an internal ribosome entry site (IRES) – type mechanism [36].
The IL4I1 gene has thus far only been found in eutherian mammals. This is supported by analysis of the genes downstream of the NUP62 orthologous genes in non-eutherian species. In Fugu rubripes, the next gene downstream of NUP62 is a homolog of human integrin alpha 6, and the two genes are oriented tail to tail. In Gallus gallus, the next gene downstream is the homolog of a human X-chromosomal gene (FLJ11016) with unknown function, and the genes are oriented head to tail. In Drosophila melanogaster, Nup62 is followed by a hypothetical WD-repeat protein (CG7989), which is in the opposite orientation (tail to tail) to Nup62. The situation in the opossum (Monodelphis domestica; thus far the only marsupial species sequenced) is unclear, as the sequence scaffold that covers NUP62 terminates 4 kb downstream and no gene is annotated there. However, the two genes that, according to annotation, flank opossum NUP62 do not map to the chromosomal region that harbors human NUP62 and IL4I1. In addition, no ortholog of the IL4I1 gene has yet been identified in the opossum genome. Thus, the evidence so far suggests that expression of variant IL4I1_2 (just as of original IL4I1) might be restricted to eutherian mammals. The sequencing and transcript analysis of more mammalian species will help to uncover the origin of the IL4I1 gene and its variant.
Mature ll4i1 protein and its variant are likely identical in sequence
Sequence alignment of N-terminal ends of peptides encoded by the IL4I1 gene (Il4i1) and the novel variant (Il4i1_2). Sequences encoded by the first coding exon are different between the two variants, and the splice site is indicated with a red arrowhead. The mouse sequence of Il4I1_2 was derived from the following ESTs: BY100275, BY099330, BY087056, BY092834 and BY088421. The rat sequence was translated from the EST CV117152. Dog and chimpanzee sequences were deduced from aligned genomic sequences [54]. The cleavage site of the signal peptidase is predicted at the same position in all sequences and is indicated with a blue arrow head.
The IL4I1_2variant is specifically expressed in testis and brain
Northern hybridization with probe specific for the mouse Il4i1_2 splice variant. Blots contained poly A+ RNA from fetal mice 7 dpc (1), 11 dpc (2), 15 dpc (3), 17 dpc (4) and adult mouse tissues (heart (5), brain (6), spleen (7), lung (8), liver (9), skeletal muscle (10), kidney (11), and testis (12). Hybridization was with a probe comprising the joining exons 2 and 3 of the mouse Il4i1_2 variant, which are equivalent to human exons 3 and 4 (red arrowheads in Fig. 1). The blots were reprobed for beta actin mRNA as control for RNA content. The probe cross-hybridized with gamma actin mRNA where expressed.
RNA in situ hybridization of variant Il4i1_2 in mouse testis. Probes were transcribed from the joining exons specific for variant Il4i1_2, which are located between the previously known Nup62 and Il4i1 gene loci. Signals (in blue) obtained with the antisense probe are on the left (A), and those obtained with sense probe are on the right (B). The scale bar is 100 μm in 1A and B, 50 μm in 2A and B.
RNA in situ hybridization of variant Il4i1_2 in different areas of adult mouse brain. Shown are sagittal sections from cerebellum (1), cortex (2), hippocampus (3) and olfactory bulb (4). Probes were transcribed from the joining exons specific for variant Il4i1_2, located between the previously known Nup62 and Il4i1 gene loci. Signals (in blue) obtained with the antisense probe are on the left (A), and those obtained with the sense probe are on the right (B). The scale bar is 500 μm in 2A and 3A, and 200 μm in the other images.
Discussion
We here report a novel transcript variant of the IL4I1 gene, which is a product of two exons from the previously described NUP62 gene, two apparently joining exons mapping between the reported NUP62 and IL4I1 gene loci, and six exons of the known IL4I1 gene. Expression of that variant is driven by the assumed NUP62 gene promoter with high tissue and cell type specificity. The protein encoded by the variant IL4I1_2 transcript is essentially the same as that of the originally described Il4i1 protein [32], since the primary structures of the encoded proteins are identical after probable cleavage of the predicted signal peptides. Although a different functionality of the variant signal peptides cannot be excluded [40], the expression of this otherwise B-cell specific gene in testis and brain already adds significantly to the previously known properties of that gene and the encoded enzyme. The tissue specificity of the reported IL4I1 promoter [31] appears to be essential for survival, and expression of that gene appears to be tightly controlled. Given the function of the encoded protein, a LAAO enzyme, such restriction of protein expression makes sense. Limiting IL4I1 expression to B cells would take reference to the specific function of that cell type (e.g. antigen processing). In contrast, the Il4i1 protein is likely not involved in the immune system/antigen processing when expressed in testis or the brain. While the function of that protein in these tissues thus remains to be established, a possible involvement in disease should be analyzed. The lysyl oxidase (LOX) has been found at elevated levels in amyotrophic lateral sclerosis (ALS) and in superoxide dismutase (mSOD1) knockout mice (which exhibit an ALS-like syndrome) and is believed to be involved in the progression of ALS [41]. The LAAO activity of Il4i1 makes this protein a new candidate not only for ALS, but also for other diseases associated with the death of Purkinje cells [42]. For example, the chromosomal location of the IL4I1 gene at 19q13.31 has been described as candidate region for spinocerebellar ataxia type SCA19. Elevated expression levels of IL4I1 have also been reported in primary mediastinal large B-cell lymphoma [43], thus associating this gene with cancer as well. Further experimentation will be necessary to establish a possible role of the variant IL4I1_2 in any of these or other diseases.
The previously described IL4I1 promoter appears to be strictly specific for B-cell expression. It does not contain a CpG island and is reported to be induced for instance by STAT6 [31]. In contrast, the IL4I1_2 variant in the human is likely to be expressed exclusively in testis and brain. The NUP62 gene has a CpG island and is ubiquitously expressed. In consequence, pre-mRNAs are spliced to produce the novel variant only in testis and brain. However Purkinje and Sertoli cells also require functional nuclear pore complexes to survive. Correct amounts of both mRNAs need to be generated within the cells. The amounts could be regulated most likely at the splicing and/or polyadenylation levels, or by specific mRNA degradation. In consequence, the variant IL4I1_2 transcript is indicative of a so far undetected mechanism of gene regulation. While the presence of alternative promoters is a common theme in many genes, the cell-type specific expression of two genes from one promoter is novel, especially when the transcripts contain exons from both genes.
Thus far, gene fusions had mostly been associated with disease [44]; for example, trans-splicing is associated with viral infection [45]. However, the process reported here occurs in normal individuals and could be essential in the expressing cell types. Apparent joining of genes as indicated by cDNA sequences takes place at a rather high rate, but in many cases these cDNAs are likely to have been the result of errors in the pre-mRNA processing machinery [46]. One example is AK074097, which points to a fusion between IL4I1 and the downstream gene encoding TBC1 domain family member 17. However, these genes are oriented tail to tail, and the sequence structure of AK074097 is not supported by any further cDNA data. AK074097 even extends into the next further downstream gene AKT1S1. The "splice variant" represented by this cDNA therefore most likely originated from the lack of transcriptional termination and mis-splicing of cryptic "exons". This cDNA could thus be regarded as biological noise [46]. While being probably not of functional relevance, this and many other similar cDNA sequences (also IMAGE:5168029) raise questions as to the fidelity of RNA production and processing in cells, and as to the requirement of biological systems to be able to tolerate such events. Since errors at the RNA level are not inherited per se, the observed phenomena presumably are indicative of the flexibility and stability of the cellular system, rather than that these RNAs themselves would contribute to the evolutionary principle directly. Our findings now suggest that promiscuity of the pre-mRNA processing machinery is a required mechanism on a higher than previously reported [5, 6, 47, 48], i.e., a trans-gene level, and that it is regulated at tissue and cell-type levels.
Alignment of NUP62 and FLJ20130. (A) Protein sequences of human, opossum and chicken Nup62 were aligned with the peptide encoded by cDNA FLJ20130. While most of the mammalian NUP62 genes do not contain introns, the chicken NUP62 gene and the human gene encoding FLJ20130 do. Exon boundaries in the latter two sequences are indicated with pipes (|), and the lack of introns is indicated at the respective positions by dashes (-). The positions of exon boundaries are additionally highlighted in yellow. The N terminus of chicken Nup62 is probably incomplete. (B) Dot-plot of human nucleotide sequences FLJ20130 (presumed ancestor of NUP62) and AL162061 (NUP62). Windowsize was 55 bp, and stringency was set to 60% sequence identity. Coding regions in the two cDNAs are indicated with blue bars, and ORF boundaries are linked to the dot-plot alignment. The alignment extends past the protein coding sequences. The terminal and coding exon of AL162061 starts at position bp 129 and comprises the assumed retroposon.
The mechanism that determines the processing of NUP62/IL4I1_2 pre-mRNAs into its final form also remains to be identified. An attractive model would be the frequently observed use of alternative polyadenylation sites that is coupled to alternative splicing [50]. Then the terminal exon of NUP62 could be interpreted as "merely" an alternative 3'-end of the IL4I1 gene, or the downstream exons of IL4I1 were alternative ends of the NUP62 gene. A possible NUP62 retroposon would have contained a polyadenylation signal and a polyA-tail. Consensus polyadenylation signals (AAUAAA) are present in the NUP62 gene and transcripts while the polyA tail appears to have vanished since the time of integration. The downstream sequence element needed to make the polyadenylation signal functional [51] and to terminate transcription must have been present within the intron of the IL4I1 gene into which the retroposon inserted.
Conclusion
We have identified and verified a novel mechanism for regulation of gene expression that involves the transcription of two genes from the same promoter and the processing of two variant mRNAs from probably the same pre-mRNA. The encoded proteins are completely unrelated. Conservation of this mechanism in eutherians suggests both transcripts and the encoded proteins are essential for survival. Finally, our finding puts the current definition of the term "gene" in question, as the variants we have identified and analyzed are clearly the product of two genes. In addition to one promoter driving the expression of these genes, two of the formerly named NUP62 exons are also part of the IL4I1_2 variant. Should these exons be counted as belonging to the NUP62 or to the IL4I1 genes? One current definition of a gene is "a complete chromosomal segment responsible making a functional product" [52]. The chromosomal segment encoding the B-cell variant of IL4I1 appears completely separate from that of NUP62 and thus fulfils all criteria of the above definition. This is not true however for the newly detected IL4I1_2 variant. NUP62 and IL4I1_2 share noncoding regulatory DNA sequences, exons and introns within one chromosomal segment. The functional sequences of NUP62 and IL4I1_2, however, are unique and distinct, which is another criterion used to separate two genes. In consequence, the above definition of a "gene" should be put in question. Nature may have more surprises to reveal, and with increasing amounts of data on genomes, transcriptomes and proteomes being collected and analyzed, other paradigms may require revision.
Methods
Identification of splice variant
The cDNA IMAGE:4822638 (Acc:BC026103) was cloned and sequenced by the Mammalian Gene Collection [26]. More cDNAs were identified in the University of California, Santa Cruz (UCSC) genome browser [53, 54] (assembly of May 2004), based on their EST sequences to cover part of the IL4I1_2 variant (IMAGE:5168029, IMAGE:5171014, IMAGE: 5742307, IMAGE:4838597). All these cDNAs were obtained from The German Resource Centre for Genome Research (RZPD; [55]) and completely sequenced with help of walking primers [56]. Sequences were assembled and aligned using the Staden package [57] to identify base substitutions and other alterations from the predicted consensus sequence.
Comparative genomic analysis
Comparative genomic analysis of the IL4I1_2 variant was done with help of the UCSC genome browser [53], which indicated variant cDNAs from mouse [58] (ESTs Acc:BY100275, BY099330, BY087056, BY092834, BY088421) and rat (Acc:CV117152). Alignment of protein sequences was done with Vector NTI software (Invitrogen). Synteny of genomic regions downstream of the NUP62 orthologs was analyzed in the genome assemblies and datasets of human (hg17), chimpanzee (panTro1), dog (canFam1), mouse (mm5), rat (rn3), opossum (monDom1), chicken (galGal2), Fugu (fr1), and Drosophila (dm1), all in the UCSC genome browser [54].
Northern hybridization
Multiple tissue Northern blots with poly-(A)+-RNA from mouse embryonic (Cat.# 636810) and mouse adult tissues (Cat.# 636808) were obtained from BD Biosciences Clontech. A probe specific for the mouse variant Il4i1_2 transcript was generated with the primers mmNupIlR1 (GAAGAACACAGGCAGATGCCCTG) and mmNupIlS1 (TGCATGGTGGTCTTTGTGGGGC), which were used to amplify the mouse joining exons 2 and 3 of the variant Il4i1_2 (equivalent to the human exons 3 and 4 indicated with red arrowheads in Fig. 1) from mouse testis RNA via RT-PCR. The 208 bp PCR product was cloned into the pCRII vector (Invitrogen), and sequence verified. Filters were hybridized with 32P-labelled purified PCR products from that clone. Hybridization was overnight in Church solution (1M Na2HPO4, 1M NaH2PO4·H2O, 10mM EDTA, pH8.0) at 65°C. Filters were washed once in 0.1% SDS/0.1xSSC for 10 min, once in 0.1% SDS/0.3xSSC for 10 min, and then exposed to Kodak Bio Max at -80°C.
RNA in situ hybridization
RNA in situ hybridization was performed on embryo sections at stages 10.5, 12.5, 14.5, 16.5 and different tissues of adult mice (testis, kidney, liver and brain). Embryos were isolated from pregnant NMRI mice. The day of plug detection was considered to be day 0.5 post conception (dpc). The tissues and embryonic stages were fixed over night in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) at 4°C. The tissues from adult NMRI mice were isolated after perfundation with 4% PFA in PBS. After embedding in paraffin, 6 μm sagittal sections were mounted on Superfrost+ slides. Cloned PCR products (see Northern hybridization) were sequence verified to identify orientation of the product within the vector. Antisense (T7) and sense (SP6) riboprobes labeled with digoxigenin-UTP (Enzo) were generated by in vitro transcription (Roche), after linearization of the constructs. Pre-treatment, hybridization and washing were carried out using a Ventana discovery system. Sense or antisense RNA probes were hybridized at 100ng RNA/ml in hybridization buffer in a volume of 100 μl/slide. Slides were analyzed using a Leica microscope.
Photographs were taken with a liquid crystal display (LCD) – camera (Power head, Sony) using AnalySIS software (Soft imaging System GmbH). The figures were assembled using Adobe Photoshop.
Notes
Declarations
Acknowledgements
We thank Jeremy Simpson for protein localization, and Ute Ernst and Hanna Bausbacher for excellent technical assistance. We thank Danielle and Jean Thierry-Mieg for interesting discussions and productive suggestions. This work was supported by the German Federal Ministry of Education and Research (BMBF) with grants 01GR0101 and 01GR0420.
Authors’ Affiliations
References
- Brett D, Pospisil H, Valcarcel J, Reich J, Bork P: Alternative splicing and genome complexity. Nat Genet. 2002, 30 (1): 29-30. 10.1038/ng803.View ArticlePubMedGoogle Scholar
- Modrek B, Lee C: A genomic view of alternative splicing. Nat Genet. 2002, 30 (1): 13-19. 10.1038/ng0102-13.View ArticlePubMedGoogle Scholar
- Ast G: How did alternative splicing evolve?. Nat Rev Genet. 2004, 5 (10): 773-782. 10.1038/nrg1451.View ArticlePubMedGoogle Scholar
- Imanishi T, Itoh T, Suzuki Y, O'Donovan C, Fukuchi S, Koyanagi KO, Barrero RA, Tamura T, Yamaguchi-Kabata Y, Tanino M, Yura K, Miyazaki S, Ikeo K, Homma K, Kasprzyk A, Nishikawa T, Hirakawa M, Thierry-Mieg J, Thierry-Mieg D, Ashurst J, Jia L, Nakao M, Thomas MM, Mulder N, Karavidopoulou Y, Jin L, Kim S, Yasuda T, Lenhard B, Eveno E, Suzuki Y, Yamasaki C, Takeda J, Gough C, Amid C, Bellgard M, de Fatima Bonaldo M, Bono H, Bromberg SK, Brookes A, Bruford E, Carninci P, Chelala C, Couillault C, de Souza S, Debily M, Devignes M, Dubchak I, Endo T, Estreicher A, Eyras E, Fukami-Kobayashi K, Gopinathrao G, Graudens E, Hahn Y, Han M, Han Z, Hanada K, Hashimoto K, Hinz U, Hirai M, Hishiki T, Hopkinson I, Imbeaud S, Inoko H, Kanapin A, Kasukawa T, Kelso J, Kersey P, Kikuno R, Kimura K, Korn B, Kuryshev V, Makalowska I, Makalowski W, Makino T, Mano S, Mariage-Samson R, Mashima J, Matsuda H, Mewes HW, Minoshima S, Nagai K, Nagasaki H, Nigam R, Ogasawara O, Ohara O, Ohtsubo M, Okada N, Okido T, OOta S, Ota M, Ota T, Otsuki T, Piatier-Tonneau D, Poustka A, Ren S, Saitou N, Sakai K, Sakamoto S, Sakate R, Schupp I, Servant F, Sherry S, Shimizu N, Shimoyama M, Simpson AJ, Soares B, Steward C, Suwa M, Suzuki M, Takahashi A, Tamiya G, Tanaka H, Taylor T, Terwilliger JD, Unneberg P, Watanabe S, Wilming L, Yasuda N, Yoo H, Veeramachaneni V, Stodolsky M, Go M, Nakai K, Takagi T, Kanehisa M, Sakaki Y, Quackenbush J, Okazaki Y, Hayashizaki Y, Hide W, Chakraborty R, Nishikawa K, Sugawara H, Tateno Y, Chen Z, Oishi M, Tonellato P, Apweiler R, Okubo K, Wagner L, Wiemann S, Strausberg RL, Isogai T, Auffray C, Nomura N, Gojobori T, Sugano S: Integrative Annotation of 21,037 Human Genes Validated by Full-Length cDNA Clones. PLoS Biol. 2004, 2 (6): 856-875. 10.1371/journal.pbio.0020162.View ArticleGoogle Scholar
- Kornblihtt AR, de la Mata M, Fededa JP, Munoz MJ, Nogues G: Multiple links between transcription and splicing. RNA. 2004, 10 (10): 1489-1498. 10.1261/rna.7100104.PubMed CentralView ArticlePubMedGoogle Scholar
- Kalnina Z, Zayakin P, Silina K, Line A: Alterations of pre-mRNA splicing in cancer. Genes Chromosomes Cancer. 2005, 42 (4): 342-357. 10.1002/gcc.20156.View ArticlePubMedGoogle Scholar
- Wheeler DL, Church DM, Edgar R, Federhen S, Helmberg W, Madden TL, Pontius JU, Schuler GD, Schriml LM, Sequeira E, Suzek TO, Tatusova TA, Wagner L: Database resources of the National Center for Biotechnology Information: update. Nucleic Acids Res. 2004, 32: D35-40. 10.1093/nar/gkh073.PubMed CentralView ArticlePubMedGoogle Scholar
- Anderson CL, Zundel MA, Werner R: Variable promoter usage and alternative splicing in five mouse connexin genes. Genomics. 2005, 85 (2): 238-244. 10.1016/j.ygeno.2004.11.007.View ArticlePubMedGoogle Scholar
- George CX, Wagner MV, Samuel CE: Expression of interferon-inducible RNA deaminase ADAR1 during pathogen infection and mouse embryo development involves tissue selective promoter utilization and alternative splicing. J Biol Chem. 2005, 280 (15): 15020-15028. 10.1074/jbc.M500476200.View ArticlePubMedGoogle Scholar
- Gebauer F, Hentze MW: Molecular mechanisms of translational control. Nat Rev Mol Cell Biol. 2004, 5 (10): 827-835. 10.1038/nrm1488.View ArticlePubMedGoogle Scholar
- de Arriba Zerpa GA, Saleh MC, Fernandez PM, Guillou F, Espinosa de los Monteros A, de Vellis J, Zakin MM, Baron B: Alternative splicing prevents transferrin secretion during differentiation of a human oligodendrocyte cell line. J Neurosci Res. 2000, 61 (4): 388-395. 10.1002/1097-4547(20000815)61:4<388::AID-JNR5>3.0.CO;2-Q.View ArticlePubMedGoogle Scholar
- Stamm S, Ben-Ari S, Rafalska I, Tang Y, Zhang Z, Toiber D, Thanaraj TA, Soreq H: Function of alternative splicing. Gene. 2005, 344: 1-20. 10.1016/j.gene.2004.10.022.View ArticlePubMedGoogle Scholar
- Stoecklin G, Ming XF, Looser R, Moroni C: Somatic mRNA turnover mutants implicate tristetraprolin in the interleukin-3 mRNA degradation pathway. Mol Cell Biol. 2000, 20 (11): 3753-3763. 10.1128/MCB.20.11.3753-3763.2000.PubMed CentralView ArticlePubMedGoogle Scholar
- Zhang H, Hu J, Recce M, Tian B: PolyA_DB: a database for mammalian mRNA polyadenylation. Nucleic Acids Res. 2005, 33: D116-120. 10.1093/nar/gki055.PubMed CentralView ArticlePubMedGoogle Scholar
- Hirano M, Noda T: Genomic organization of the mouse Msh4 gene producing bicistronic, chimeric and antisense mRNA. Gene. 2004, 342 (1): 165-177. 10.1016/j.gene.2004.08.016.View ArticlePubMedGoogle Scholar
- Stallmeyer B, Drugeon G, Reiss J, Haenni AL, Mendel RR: Human molybdopterin synthase gene: identification of a bicistronic transcript with overlapping reading frames. Am J Hum Genet. 1999, 64 (3): 698-705. 10.1086/302295.PubMed CentralView ArticlePubMedGoogle Scholar
- Veeramachaneni V, Makalowski W, Galdzicki M, Sood R, Makalowska I: Mammalian overlapping genes: the comparative perspective. Genome Res. 2004, 14 (2): 280-286. 10.1101/gr.1590904.PubMed CentralView ArticlePubMedGoogle Scholar
- Makalowska I, Lin CF, Makalowski W: Overlapping genes in vertebrate genomes. Comput Biol Chem. 2005, 29 (1): 1-12. 10.1016/j.compbiolchem.2004.12.006.View ArticlePubMedGoogle Scholar
- Poulin F, Brueschke A, Sonenberg N: Gene fusion and overlapping reading frames in the mammalian genes for 4E-BP3 and MASK. J Biol Chem. 2003, 278 (52): 52290-52297. 10.1074/jbc.M310761200.View ArticlePubMedGoogle Scholar
- Alfonso A, Grundahl K, McManus JR, Asbury JM, Rand JB: Alternative splicing leads to two cholinergic proteins in Caenorhabditis elegans. J Mol Biol. 1994, 241 (4): 627-630. 10.1006/jmbi.1994.1538.View ArticlePubMedGoogle Scholar
- Gustin KE, Sarnow P: Effects of poliovirus infection on nucleo-cytoplasmic trafficking and nuclear pore complex composition. EMBO J. 2001, 20 (1–2): 240-249. 10.1093/emboj/20.1.240.PubMed CentralView ArticlePubMedGoogle Scholar
- Zhong H, Takeda A, Nazari R, Shio H, Blobel G, Yaseen NR: Carrier-independent nuclear import of the transcription factor PU.1 via RANGTP-stimulated binding to NUP153. J Biol Chem. 2005, 280 (11): 10675-10682. 10.1074/jbc.M412878200.View ArticlePubMedGoogle Scholar
- Swissprot Proteomics Server. [http://www.expasy.org]
- Carmo-Fonseca M, Kern H, Hurt EC: Human nucleoporin p62 and the essential yeast nuclear pore protein NSP1 show sequence homology and a similar domain organization. Eur J Cell Biol. 1991, 55 (1): 17-30.PubMedGoogle Scholar
- Mans BJ, Anantharaman V, Aravind L, Koonin EV: Comparative Genomics, Evolution and Origins of the Nuclear Envelope and Nuclear Pore Complex. Cell Cycle. 2004, 3 (12): 1612-1637.View ArticlePubMedGoogle Scholar
- Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T, Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL, Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P, Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH, Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW, Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW, Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U, Smailus DE, Schnerch A, Schein JE, Jones SJ, Marra MA: Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA. 2002, 99 (26): 16899-16903. 10.1073/pnas.242603899.View ArticlePubMedGoogle Scholar
- Wiemann S, Weil B, Wellenreuther R, Gassenhuber J, Glassl S, Ansorge W, Bocher M, Blocker H, Bauersachs S, Blum H, Lauber J, Dusterhoft A, Beyer A, Kohrer K, Strack N, Mewes HW, Ottenwalder B, Obermaier B, Tampe J, Heubner D, Wambutt R, Korn B, Klein M, Poustka A: Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs. Genome Res. 2001, 11 (3): 422-435. 10.1101/gr.GR1547R.PubMed CentralView ArticlePubMedGoogle Scholar
- Chu CC, Paul WE: Fig1, an interleukin 4-induced mouse B cell gene isolated by cDNA representational difference analysis. Proc Natl Acad Sci USA. 1997, 94 (6): 2507-2512. 10.1073/pnas.94.6.2507.PubMed CentralView ArticlePubMedGoogle Scholar
- Chu CC, Paul WE: Expressed genes in interleukin-4 treated B cells identified by cDNA representational difference analysis. Mol Immunol. 1998, 35 (8): 487-502. 10.1016/S0161-5890(98)00031-5.View ArticlePubMedGoogle Scholar
- Mason JM, Naidu MD, Barcia M, Porti D, Chavan SS, Chu CC: IL-4-induced gene-1 is a leukocyte L-amino acid oxidase with an unusual acidic pH preference and lysosomal localization. J Immunol. 2004, 173 (7): 4561-4567.View ArticlePubMedGoogle Scholar
- Schroder AJ, Pavlidis P, Arimura A, Capece D, Rothman PB: Cutting edge: STAT6 serves as a positive and negative regulator of gene expression in IL-4-stimulated B lymphocytes. J Immunol. 2002, 168 (3): 996-1000.View ArticlePubMedGoogle Scholar
- Chavan SS, Tian W, Hsueh K, Jawaheer D, Gregersen PK, Chu CC: Characterization of the human homolog of the IL-4 induced gene-1 (Fig1). Biochim Biophys Acta. 2002, 1576 (1–2): 70-80.View ArticlePubMedGoogle Scholar
- Kozak M: Initiation of translation in prokaryotes and eukaryotes. Gene. 1999, 234 (2): 187-208. 10.1016/S0378-1119(99)00210-3.View ArticlePubMedGoogle Scholar
- Bendtsen JD, Nielsen H, von Heijne G, Brunak S: Improved prediction of signal peptides: SignalP 3.0. J Mol Biol. 2004, 340 (4): 783-795. 10.1016/j.jmb.2004.05.028.View ArticlePubMedGoogle Scholar
- Oyama M, Itagaki C, Hata H, Suzuki Y, Izumi T, Natsume T, Isobe T, Sugano S: Analysis of small human proteins reveals the translation of upstream open reading frames of mRNAs. Genome Res. 2004, 14 (10B): 2048-2052. 10.1101/gr.2384604.PubMed CentralView ArticlePubMedGoogle Scholar
- Fernandez J, Yaman I, Huang C, Liu H, Lopez AB, Komar AA, Caprara MG, Merrick WC, Snider MD, Kaufman RJ, Lamers WH, Hatzoglou M: Ribosome Stalling Regulates IRES-Mediated Translation in Eukaryotes, a Parallel to Prokaryotic Attenuation. Mol Cell. 2005, 17 (3): 405-416. 10.1016/j.molcel.2004.12.024.View ArticlePubMedGoogle Scholar
- Simpson JC, Wellenreuther R, Poustka A, Pepperkok R, Wiemann S: Systematic subcellular localization of novel proteins identified by large scale cDNA sequencing. EMBO Rep. 2000, 1 (3): 287-292. 10.1093/embo-reports/kvd058.PubMed CentralView ArticlePubMedGoogle Scholar
- Bannasch D, Mehrle A, Glatting K-H, Pepperkok R, Poustka A, Wiemann S: LIFEdb: A database for functional genomics experiments integrating information from external sources, and serving as a sample tracking system. Nucleic Acids Res. 2004, 32 (1): D505-508. 10.1093/nar/gkh022.PubMed CentralView ArticlePubMedGoogle Scholar
- DKFZ Database for Localization, Interaction, Functional assays and Expression of human Proteins. [http://www.lifedb.de]
- Martoglio B: Intramembrane proteolysis and post-targeting functions of signal peptides. Biochem Soc Trans. 2003, 31 (pt 6): 1243-1247.View ArticlePubMedGoogle Scholar
- Li PA, He Q, Cao T, Yong G, Szauter KM, Fong KS, Karlsson J, Keep MF, Csiszar K: Up-regulation and altered distribution of lysyl oxidase in the central nervous system of mutant SOD1 transgenic mouse model of amyotrophic lateral sclerosis. Mol Brain Res. 2004, 120 (2): 115-122. 10.1016/j.molbrainres.2003.10.013.View ArticlePubMedGoogle Scholar
- Sarna JR, Hawkes R: Patterned Purkinje cell death in the cerebellum. Prog Neurobiol. 2003, 70 (6): 473-507.View ArticlePubMedGoogle Scholar
- Copie-Bergman C, Boulland ML, Dehoulle C, Moller P, Farcet JP, Dyer MJ, Haioun C, Romeo PH, Gaulard P, Leroy K: Interleukin 4-induced gene 1 is activated in primary mediastinal large B-cell lymphoma. Blood. 2003, 101 (7): 2756-2761. 10.1182/blood-2002-07-2215.View ArticlePubMedGoogle Scholar
- Hahn Y, Bera TK, Gehlhaus K, Kirsch IR, Pastan IH, Lee B: Finding fusion genes resulting from chromosome rearrangement by analyzing the expressed sequence databases. Proc Natl Acad Sci USA. 2004, 101 (36): 13257-13261. 10.1073/pnas.0405490101.PubMed CentralView ArticlePubMedGoogle Scholar
- Caudevilla C, Da Silva-Azevedo L, Berg B, Guhl E, Graessmann M, Graessmann A: Heterologous HIV-nef mRNA trans-splicing: a new principle how mammalian cells generate hybrid mRNA and protein molecules. FEBS Lett. 2001, 507 (3): 269-279. 10.1016/S0014-5793(01)02957-X.View ArticlePubMedGoogle Scholar
- Lareau LF, Green RE, Bhatnagar RS, Brenner SE: The evolving roles of alternative splicing. Curr Opin Struct Biol. 2004, 14 (3): 273-282. 10.1016/j.sbi.2004.05.002.View ArticlePubMedGoogle Scholar
- Nogues G, Kadener S, Cramer P, de la Mata M, Fededa JP, Blaustein M, Srebrow A, Kornblihtt AR: Control of alternative pre-mRNA splicing by RNA Pol II elongation: faster is not always better. IUBMB Life. 2003, 55 (4–5): 235-241.PubMedGoogle Scholar
- Shomron N, Alberstein M, Reznik M, Ast G: Stress alters the subcellular distribution of hSlu7 and thus modulates alternative splicing. J Cell Sci. 2005, 118 (pt 6): 1151-1159. 10.1242/jcs.01720.View ArticlePubMedGoogle Scholar
- Wang PJ: X chromosomes, retrogenes and their role in male reproduction. Trends Endocrinol Metab. 2004, 15 (2): 79-83. 10.1016/j.tem.2004.01.007.View ArticlePubMedGoogle Scholar
- Proudfoot NJ, Furger A, Dye MJ: Integrating mRNA processing with transcription. Cell. 2002, 108 (4): 501-512. 10.1016/S0092-8674(02)00617-7.View ArticlePubMedGoogle Scholar
- Proudfoot N: New perspectives on connecting messenger RNA 3' end formation to transcription. Curr Opin Cell Biol. 2004, 16 (3): 272-278. 10.1016/j.ceb.2004.03.007.View ArticlePubMedGoogle Scholar
- Snyder M, Gerstein M: Genomics. Defining genes in the genomics era. Science. 2003, 300 (5617): 258-260. 10.1126/science.1084354.View ArticlePubMedGoogle Scholar
- Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, Haussler D: The Human Genome Browser at UCSC. Genome Res. 2002, 12 (6): 996-1006. 10.1101/gr.229102. Article published online before print in May 2002.PubMed CentralView ArticlePubMedGoogle Scholar
- UCSC Genome Browser. [http://genome.ucsc.edu/]
- Deutsches Ressourcenzentrum für Genomforschung. [http://www.rzpd.de]
- Haas S, Vingron M, Poustka A, Wiemann S: Primer design for large scale sequencing. Nucleic Acids Res. 1998, 26 (12): 3006-3012. 10.1093/nar/26.12.3006.PubMed CentralView ArticlePubMedGoogle Scholar
- Staden R: The Staden sequence analysis package. Mol Biotechnol. 1996, 5 (3): 233-241.View ArticlePubMedGoogle Scholar
- Okazaki Y, Furuno M, Kasukawa T, Adachi J, Bono H, Kondo S, Nikaido I, Osato N, Saito R, Suzuki H, Yamanaka I, Kiyosawa H, Yagi K, Tomaru Y, Hasegawa Y, Nogami A, Schonbach C, Gojobori T, Baldarelli R, Hill DP, Bult C, Hume DA, Quackenbush J, Schriml LM, Kanapin A, Matsuda H, Batalov S, Beisel KW, Blake JA, Bradt D, Brusic V, Chothia C, Corbani LE, Cousins S, Dalla E, Dragani TA, Fletcher CF, Forrest A, Frazer KS, Gaasterland T, Gariboldi M, Gissi C, Godzik A, Gough J, Grimmond S, Gustincich S, Hirokawa N, Jackson IJ, Jarvis ED, Kanai A, Kawaji H, Kawasawa Y, Kedzierski RM, King BL, Konagaya A, Kurochkin IV, Lee Y, Lenhard B, Lyons PA, Maglott DR, Maltais L, Marchionni L, McKenzie L, Miki H, Nagashima T, Numata K, Okido T, Pavan WJ, Pertea G, Pesole G, Petrovsky N, Pillai R, Pontius JU, Qi D, Ramachandran S, Ravasi T, Reed JC, Reed DJ, Reid J, Ring BZ, Ringwald M, Sandelin A, Schneider C, Semple CA, Setou M, Shimada K, Sultana R, Takenaka Y, Taylor MS, Teasdale RD, Tomita M, Verardo R, Wagner L, Wahlestedt C, Wang Y, Watanabe Y, Wells C, Wilming LG, Wynshaw-Boris A, Yanagisawa M, Yang I, Yang L, Yuan Z, Zavolan M, Zhu Y, Zimmer A, Carninci P, Hayatsu N, Hirozane-Kishikawa T, Konno H, Nakamura M, Sakazume N, Sato K, Shiraki T, Waki K, Kawai J, Aizawa K, Arakawa T, Fukuda S, Hara A, Hashizume W, Imotani K, Ishii Y, Itoh M, Kagawa I, Miyazaki A, Sakai K, Sasaki D, Shibata K, Shinagawa A, Yasunishi A, Yoshino M, Waterston R, Lander ES, Rogers J, Birney E, Hayashizaki Y: Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature. 2002, 420 (6915): 563-573. 10.1038/nature01266.View ArticlePubMedGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.