The calcium receptor decreases parathyroid hormone mRNA levels post-transcriptionally in HEK293 cells

PTH gene expression is regulated post-transcriptionally by Ca²⁺ and calcimimetics affecting PTH mRNA stability [7, 15]. To focus on the effect of the CaR on PTH mRNA stability in a cell system we constructed an expression vector containing the full-length human PTH gene including its three exons and two introns (hPTH) driven by a viral SV40 (not shown) or CMV promoter (Figure 1A). Expression of PTH from both viral promoters gave similar results and we used the CMV promoter for further studies.

The hPTH expression plasmid was transiently transfected into HEK293 cells. The transcribed PTH mRNA was correctly spliced resulting in PTH mRNA of the expected size (Figure 1D). The PTH mRNA was translated into mature human PTH that was measured in the medium by radioimmunoassay (Figure 1F). We then studied the effect of the CaR on PTH mRNA levels in HEK293 cells expressing the PTH gene by transient transfection. The expression of the CaR was confirmed by immunohistochemistry on whole cells using an intact cell enzyme-linked immunoassay to determine cell surface expression [28] (Figure 1B) and by western blot (Figure 1C). Transfection efficiency was >95%, as indicated by fluorescent microscopy of the cells co-transfected with a green fluorescent protein (GFP) expression plasmid (not shown). Co-transfection of the human (h) CaR together with the hPTH plasmid resulted in a marked decrease in PTH mRNA levels by Northern blot (Figure 1D) and real time RT PCR (qPCR) (Figure 1E) corrected for co-transfected control genes GH (Figure 1E) or endogenous HPRT (Figure 1G). The decrease in PTH mRNA by the CaR was reflected in a decrease in secreted PTH at 48 h (Figure 1F). Transfection with another G protein coupled receptor (GPCR), the PTH receptor (PTH1R) had no effect on PTH mRNA levels, confirming the specificity of the CaR effect on PTH mRNA (Figure 1G).

The calcium receptor decreases parathyroid hormone mRNA levels through the parathyroid hormone mRNA 3'-UTR AU-rich element

We have previously reported that the regulation of PTH mRNA levels is dependent upon a cis-acting instability ARE in the PTH mRNA 3'-UTR [15, 16, 20]. We then determined if the regulation of PTH mRNA levels by the CaR is exerted through the PTH mRNA ARE, using a growth hormone (GH) reporter gene containing either the rat PTH 63 nt ARE (GH63) or a truncated non-functional PTH mRNA 40 nt element [29]. Over-expression of the CaR decreased GH63 mRNA levels but had no effect on wild-type GH mRNA levels or on a GH mRNA with the truncated 40 nt PTH mRNA ARE (Figure 2A). Our results indicate that the CaR specifically decreases PTH mRNA levels through the PTH mRNA ARE.

To study the effect of the CaR on PTH mRNA stability we used an in vitro degradation assay (IVDA) [16, 20]. A radiolabeled polyadenylated in vitro-transcribed hPTH mRNA was incubated with extracts from cells transfected with either the CaR expression plasmid or a control plasmid. The amount of intact PTH mRNA remaining with time represents the decay of the transcript by the different extracts and is indicative of the decay rate in vivo [15, 30]. The rate of PTH mRNA decay was increased by extracts from cells expressing the CaR compared with extracts from cells with control plasmid correlating with PTH mRNA levels in the transfected cells (Figure 2B, top gel and Figure 2C). We then performed IVDA using polyadenylated PTH mRNA with an internal deletion of the ARE (Figure 2B, bottom gel and Figure 2C). The PTH mRNA transcript lacking the ARE was stable throughout the experiment and in contrast to the full-length PTH mRNA, was not affected by expression of the CaR (Figure 2B and 2C). Our results indicate that the CaR specifically decreases steady-state PTH mRNA levels and PTH mRNA stability through the PTH mRNA ARE.

Protein-PTH mRNA interactions by RNA immunoprecipitation assays

In vivo in the rat parathyroid, PTH mRNA stability is determined by the regulated binding of AUF1 and KSRP to the PTH mRNA 3'-UTR [20]. To identify protein-mRNA interactions in the CaR transfected cells, we performed RNA immunoprecipitation (RIP) assays using extracts from HEK293 cells transfected with the CaR or control plasmids. Immunoprecipitation was performed with antibodies to AUF1, KSRP or control IgG followed by qRT PCR of the recovered RNA and input extracts. Parathyroid hormone mRNA was decreased in the CaR expressing extracts compared with control extracts (Figure 3A) as above (Figure 1D, 1E and 1G). The RIP assay showed that the amount of PTH mRNA bound to AUF1 was decreased in CaR-expressing cells compared with control cells (Figure 3B). In contrast, PTH mRNA bound to KSRP was increased in the CaR-expressing cells (Figure 3C). This binding pattern is consistent with the stabilizing function of AUF1 and the destabilizing function of KSRP on PTH mRNA [18, 20]. The increased binding to KSRP and the decreased binding to AUF1 correlate with the lower levels of PTH mRNA induced by the CaR in the transfected cells.

The calcium receptor leads to post-translational modification of the parathyroid hormone mRNA binding protein AUF1

In vivo dietary-induced hypocalcemia and hypophosphatemia as well as adenine-induced renal failure and the calcimimetic R568 lead to post-translational modifications of AUF1 as shown by 2D gels [7, 27]. To determine whether the effect of the CaR on PTH mRNA stability in the engineered cells involves post-translational modifications of AUF1 as it does in the parathyroid, we performed 2D gels on extracts from HEK293 cells transfected with the CaR expression plasmid or an empty vector as control. AUF1 has four isoforms of p37, p40, p42 and p45. There was no difference in AUF1 protein levels in the 1D gels between cells with and without the CaR, apart from a small decrease in p45 in the CaR-expressing cells (Figure 4A). However, 2D gels showed that endogenous AUF1 isoforms p37, p40 and p42 had a different distribution of the spots between extracts of cells with and without the CaR (Figure 4B). These results suggest that the CaR induces post-translational modifications in AUF1 in the transfected cells.

To analyze the four isoforms of AUF1 separately, we utilized myc-tagged AUF1 expression plasmids. HEK293 cells were transiently transfected with expression plasmids for myc- p37, p40, p42 or p45 isoforms of AUF1 together with the CaR or control plasmids. Cell extracts were analyzed on 2D gels with an anti-myc antibody. CaR expression led to changes in mobility of myc-AUF1 p37, p40 and also p45 but not p42 (Figure 4C). Unlike the changes in myc-AUF1 p45, endogenous AUF1 p45 was only slightly modified by CaR signaling. The change in endogenous p42 was not reflected in the myc-tagged transfected p42. The reasons for these discrepancies are not clear. AUF1 p40 undergoes reversible phosphorylation which may regulate ARE-directed mRNA turnover [31, 32]. We therefore added a non-specific phosphatase to extracts from cells expressing myc-p40 with or without the CaR. Calf intestinal phosphatase (CIP) treatment of control extracts modified AUF1 to the form present in CaR-expressing extracts (Figure 4D). Treatment with CIP had no further effect on the CaR-expressing extracts. These results indicate that the CaR modifies AUF1 post-translationally and suggests that at least part of this change involves phosphorylation of isoform p40.

Parathyroid hormone mRNA levels are regulated by [Ca²⁺]_oand the calcimimetic R568 through the calcium receptor

We then studied the effect of a low-calcium medium on the regulation of PTH gene expression by the CaR in the transfected cells. HEK293 cells transiently co-transfected with expression plasmids for PTH and the CaR or a control plasmid were grown in a medium with either 0.2 or 1.2 mM Ca²⁺. Expression of the CaR decreased PTH mRNA in cells grown in physiological 1.2 mM Ca²⁺ concentration by both Northern blots and qRT PCR (Figure 5A and 5B) as in Figure 1. Importantly, the low-Ca²⁺ medium attenuated the decrease in PTH mRNA levels induced by the CaR (Figure 5A and 5B). There was no effect of a low-Ca²⁺ medium in cells that did not express the CaR.

Calcimimetics are compounds that bind and activate the CaR [5]. We then performed the same experiments with and without the calcimimetic, R568 (Figure 4C). The CaR decreased PTH mRNA levels as before at 1.2 mM Ca²⁺ (Figure 5C). Activation of the CaR by R568 decreased PTH mRNA levels at 1.2 mM Ca²⁺ (Figure 5C) and also at 0.2 mM Ca²⁺ (Figure 5D). 0.2 mM Ca²⁺ prevented the decrease in PTH mRNA levels due to the CaR (Figure 5B and 5D). However, at 0.2 mM Ca²⁺ the addition of R568 still effectively decreased PTH mRNA levels (Figure 5D). There was no effect of CaR expression on co-transfected GFP mRNA levels (Figure 5D) used as a control for transfection efficiency and loading. There was also no effect of R568 on PTH mRNA levels in cells co-transfected with the control plasmid that did not express the CaR (Figure 5C and 5D). The effect of R568 on PTH mRNA levels in the CaR-transfected cells at 0.2 mM Ca²⁺ indicates that the calcimimetic is effective at activating the CaR even when the CaR is in a relaxed configuration. Therefore, in these engineered cells, the CaR is permissive for the effect of [Ca²⁺]_o and R568 on PTH mRNA levels.

Cells and transfection

HEK293 cells were transiently co-transfected in a 10 cm dish with 5 μg expression plasmids for the PTH gene and the CaR plasmid or a control plasmid using a Calcium Phosphate Transfection Kit (Sigma, St Louis, MO, USA). At 48 h the cells expressing the CaR or controls were detached and replated in 24 well plates and treated as indicated, in triplicates for 48 h. Cells were grown in DMEM supplemented with 10% Fetal Bovine Serum (Biological Industries, Beit Haemek, Israel), L-Glutamine (Biological Industries, Beit Haemek, Israel) and Pen-Strep solution (Biological Industries, Beit Haemek, Israel). Calcium concentration in the medium was 1.2 mM. In some experiments Ca²⁺-free DMEM medium was used (0.2 mM Ca²⁺) and CaCl₂ was added as indicated. R568, a gift from Amgen (Thousand Oaks, CA, USA) was dissolved in DDW and added to the medium at a final concentration of 1 μM.

RNA extraction and analysis

RNA extraction was performed using Tri reagent (Molecular Research Center, Cincinnati, OH, USA). mRNA concentration was determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies; Wilmington, DE, USA). For real-time PCR 1 μg mRNA was used as template for RT PCR with Maxime RT PreMix (Random primer) from iNtRON (Gyeonggi-do, Korea). qPCR was performed using SYBR Green ROX Mix (ABgene, Surrey, UK) according to the manufacturer's instructions in 7900HT Fast Real-Time PCR Systems from Applied Biosystems.

The following primers were used: hPTH (5'-gggtctgcagtccaattcat-3' and 5'-cagatttcccatccgatttt-3'), hGH (5'-gggaggctggaagatggc-3' and 5'-cgttgtgtgagtttgtgtcgaac-3'), hHPRT (5' tttgaatcatgtttgtgtcattagtga and 5' ttccaaactcaacttgaactctcatc). For Northern analysis RNA was run on agarose formaldehyde gels and blotted using a Hybond-N membrane (Amersham Biosciences, Little Chalfont, UK). Membranes were hybridized to fragments for hPTH or GFP [20, 29]. In some experiments ethidium bromide staining of membranes was used for quantification of 18S or 28S as loading controls.

Plasmids

For the hPTH expression plasmid, a HpaII fragment including the three exons and two introns of the hPTH gene from plasmid pPTHg108 [20] was inserted downstream of the CMV promoter in pcDNA3 expression plasmid (Invitrogen, San Diego, CA, USA). The hCaR plasmid was kindly provided by M Lohse (Wurzburg, Germany), the GFP pEGFP-C1 (Clontech, Palo Alto, CA, USA) and hGH (kindly provided by O Meyuhas, Jerusalem, Israel [45]) were used as controls. The GH-PTH63 or GH-tPTH40 expression plasmids contained 63 bp or a truncated 40 bp fragments of the PTH mRNA 3'-UTR ARE that were inserted between the coding region and the 3'-UTR of GH mRNA [29]. hPTH1R was provided by MA Levine, Cleveland, OH, USA). In some experiments cells co-transfected with the GFP plasmid were analyzed by fluorescent microscopy to estimate transfection efficiency, which was always >90%.

Immunoreactive parathyroid hormone

Medium was replaced 1 h prior to collection and analyzed using the Immulite 2000 Intact PTH assay (Los Angeles, CA, USA)

In Vitro Degradation Assays

Radiolabeled transcripts (200,000 cpm) were incubated with 40 μg protein extract from cells in a volume of 50 μl and in a reaction buffer containing 3 mM Tris HCl, pH 7.5, 2 mM MgCl₂, 3 mM NaCl, 10 mM ATP and 30 units RNasin. At timed intervals samples were removed, RNA extracted, separated on agarose gels and analyzed by autoradiography as described [15].

The following plasmids were used as templates for RNA transcription: pBluescript II KS plasmid containing either the full-length rat PTH cDNA (772 bp) or a PTH cDNA with an internal deletion of the PTH mRNA ARE and a stretch of ~150 dT nucleotides that by in vitro transcription produced a poly(A) tail. The plasmids were linearized with SmaI [20].

2D gel electrophoresis

Analysis was performed as previously described [27].

RNA immunoprecipitation

Transiently transfected cells were grown in a 14 cm dish for 48 h, collected in ice-cold PBS, pelleted and re-suspended in RIPA buffer (containing 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS and protease inhibitors) supplemented with RNase inhibitors (Promega, Madison, WI, USA) and homogenized by pipetting. Equal amounts of whole cell extracts were immunoprecipitated with Protein A agarose-bound anti-KSRP or AUF1 antibody beads (Calbiochem, Darmstadt, Germany) or IgG as control after incubation for 2 hr at 4°C. The beads were then washed with modified RIPA buffer (supplemented with 1 M NaCl, 1% Sodium Deoxycholate, 1 mM EDTA and 2 M urea). RNA was extracted and analyzed by qPCR for PTH and GH mRNA using SYBR Green ROX Mix as described above.

Intact cell enzyme-linked immunoassay

The assay was performed as previously described [27]. In brief: 48 h after transfection cells were detached in PBS supplemented with BSA and EDTA. The cells were then pelleted and incubated for 1 h at 4°C with the anti-CaR antibody followed by PBS wash (× 3) and incubation with the secondary HRP-conjugated antibody. Cells were then washed (× 3) prior to adding the HRP substrate and the fluorescent signal was visualized using an electrochemiluminescent reader.

Antibodies

Anti-KSRP was a gift from R Gherzi, Genoa, Italy. Anti-AUF was from Upstate (Charlottesville, VA, USA). Anti-myc was from Cell Signaling (Boston, MA, USA). Anti-CaR was from Abcam (Cambridge, UK).

Statistics

Statistical analysis was performed using Microsoft Excel (Microsoft Corporation, Redmond, WA, USA). Values are reported as mean ± SEM unless stated otherwise. A 2-tailed Student's T-test was used to assess differences from the control group. A P value of less than 0.05 was considered significant.