A tissue-specific protein purification approach in Caenorhabditis elegans identifies novel interaction partners of DLG-1/Discs large

A biotinylation-based tissue-specific protein purification approach

To purify protein from specific tissues, we express Avi-tagged proteins of interest from their native regulatory sequences, while biotinylation in a specific tissue is accomplished by expressing BirA from tissue-specific promoters (Fig. 1a). Expression of the bait protein from its native regulatory sequences has several advantages. First, expression will closely mimic the endogenous expression pattern. Second, functionality of the tagged protein can be tested by crossing the transgenic strain with a strain carrying a mutation in the corresponding gene. This simultaneously creates a strain that does not express the untagged endogenous protein. Finally, only a single transgenic strain needs to be created, which can then be crossed to multiple BirA driver strains to purify the protein of interest from different tissues (Fig. 1a). As a first step, we generated four distinct BirA driver strains expressing C. elegans codon-optimized and Myc-tagged BirA ligase under the control of different promoters. Two transgenic strains express BirA in epithelial tissues, one expresses BirA in the intestine from the elt-2 promoter, and one expresses BirA in the seam and hyp7 epidermal cells from the wrt-2 promoter (wrt-2 expresses predominantly in seam cells, with weak expression in hyp7) [25]. In addition, we generated strains expressing BirA ubiquitously (using the rps-27 promoter), and in neuronal cells (using the rgef-1 promoter). Reverse transcription (RT)-PCR of transgenic animals expressing BirA from the rgef-1 promoter showed that the BirA transgene was properly transcribed and spliced (Additional file 1: Figure S1).

We designed N- and C-terminal tags consisting of GFP and the Avi sequence, separated by two Tobacco etch virus (TEV) cleavage sites, which we term the GTA tag (for GFP, TEV, Avi) (Fig. 1b, Additional file 2: Figure S2, and Additional file 3: Figure S3). The presence of GFP enables the examination of the expression pattern and subcellular localization of the protein of interest, either to confirm that the tagged protein localizes as expected or to study the localization of proteins whose localization pattern has not yet been (fully) described. Tags combining GFP with affinity purification, including a similar tag incorporating the Avi sequence, have been used successfully in C. elegans [10, 19]. The use of TEV cleavage sites is necessary to eliminate biotinylated proteins naturally present in C. elegans, which will also bind to streptavidin-coated beads. TEV cleavage releases the bait protein and any associated proteins from the beads, while naturally biotinylated background proteins remain bound. GFP, TEV, and Avi are separated by short flexible linkers of five small amino acids, while GFP is separated from the bait protein by a longer flexible linker of 13 small amino acids (Additional file 1: Figure S1 and Additional file 2: Figure S2).

To add the tags to genes encoding proteins of interest, we used fosmid recombineering, a homologous recombination-based genetic engineering technique in bacteria [26]. This approach enabled us to integrate the tag into large regions of genomic DNA (30–40 kb) that likely contain all the native regulatory sequences of the gene of interest, including the promoter, 3′ UTR, and introns (Fig. 1b).

An overview of the entire tagging and AP/MS procedure is shown in Fig. 2. Transgenic strains expressing GTA-tagged proteins are generated by germline injection of engineered fosmids, and the transgenic array is integrated into the genome by gamma irradiation. Transgenic strains expressing the GTA-tagged bait protein are then crossed to BirA-expressing strains. Whenever possible, transgenic strains are also crossed to strains carrying a mutation in the endogenous protein of interest. This allows testing to determine if the tagged protein is fully functional and eliminates the presence of wild-type untagged protein, which would otherwise reduce the fraction of complexes incorporating a tagged protein. The strains are grown at a large scale in liquid culture before harvesting, lysis, and purification of biotinylated proteins with streptavidin-coated beads. The bait protein and any bound proteins are then cleaved off the beads using TEV protease, and analyzed by tandem mass spectrometry (MS/MS) to determine their identities.

In vivo biotinylation and purification are highly tissue-specific

Tissue-specific expression of BirA should result in purification of the bait protein specifically from that tissue. However, at least two potential problems might give rise to biotinylation – and thus purification – of proteins from unintended tissues. First, if the expression of BirA is not tightly limited to the tissue of interest, BirA might be expressed at low levels in other tissues. However, many promoters with well-documented and highly tissue-specific expression patterns have been identified in C. elegans. Second, BirA might biotinylate Avi-tagged proteins after the lysis procedure, when proteins from the entire animal are mixed together. The risk of this is low, as BirA activity requires the presence of bivalent ions, which are chelated by the EDTA in the lysis buffer [27]. Nevertheless, we first wished to demonstrate the specificity of biotinylation and purification from a specific tissue.

To test the tissue specificity of our approach, we generated transgenic C. elegans strains expressing cytoplasmic Avi-tagged GFP from the intestinal elt-2 promoter and the seam and hyp7 epidermal wrt-2 promoter. Both GTA strains showed expression of cytoplasmic GFP in the expected cells (Fig. 3a, b). We crossed each GTA strain with both epithelial BirA driver strains. Of the four resulting strains, two expressed the biotin ligase and GTA in the same tissue (intestine or epidermal cells), while the other two expressed BirA and GTA in two different tissues. Animals of all four strains were lysed, biotinylated proteins were purified using streptavidin-coated beads, and the presence of GFP was examined by western blot with an antibody directed against GFP. All samples showed the expected purification pattern: when BirA and GTA were present in the same tissue, GTA was purified by the streptavidin beads; when BirA and GTA were expressed in separate tissues, no GTA was purified (Fig. 3c). Thus, in vivo biotinylation and protein purification are highly tissue specific.

GTA-tagged bait proteins are functional and recapitulate known localization patterns

To test the tissue-specific purification approach, we tagged five polarity regulators that show distinct subcellular localization patterns with the GTA tag: the apical protein PAR-3, the junctional protein DLG-1, the basolateral proteins LET-413 and LGL-1, and the cortical protein CDC-42. These five proteins all contain multiple protein–protein interaction domains and for some of these proteins, interacting partners have already been identified in C. elegans or other systems. For example, DLG-1 interacts with the C. elegans-specific protein AJM-1, whereas PAR-3 and LGL-1 can both form a complex with PKC-3 and PAR-6, and CDC-42 binds to PAR-6 [28–33]. For PAR-3, DLG-1, LET-413, and LGL-1, we added the GTA tag to the C-terminus, as C-terminal tags are more often compatible with protein function than N-terminal tags [34]. For CDC-42, we used the N-terminal tag, as it has already been shown that C. elegans GFP::CDC-42 is able to localize to the cortex, similar to wild-type CDC-42 [28]. For all five genes, we successfully generated integrated transgenic strains using the procedure outlined in Fig. 2. We examined the expression pattern of the tagged bait proteins in the intestine and seam cells and found that all proteins localized to the expected subcellular domains (Fig. 4). In both tissues we observed junctional localization of DLG-1::GTA, basolateral localization of LET-413::GTA and LGL-1::GTA, and cortical localization of GTA::CDC-42. PAR-3::GTA was visible at the apical surface of the seam cells. Unexpectedly, no tagged PAR-3 was detected in the intestinal epithelium. In addition to the epithelial localization, we also observed expression of DLG-1::GTA in ventral cord neurons (Fig. 4d), which is consistent with the expression in neurons of the human homolog DLG4 (PSD-95) [35].

We crossed the dlg-1, lgl-1, and let-413 GTA-tagged transgenic strains with strains carrying a mutant allele of the corresponding endogenous gene. cdc-42 and par-3 null alleles are early embryonic lethal [36, 37]. Transgenes are usually silenced in the germline and are therefore unlikely to rescue these phenotypes. Consequently, we did not use mutant backgrounds for these two bait proteins.

The dlg-1::GTA transgenic strain was crossed with a strain carrying the dlg-1(ok318) deletion allele, which causes embryonic arrest at the 2-fold stage. Homozygous dlg-1(ok318) mutants carrying the dlg-1::GTA transgene were fully viable, demonstrating that the DLG-1::GTA protein is functional. Loss of lgl-1 does not affect cell polarity or viability, preventing a complementation test of the functionality of the lgl-1::GTA transgene [38, 39]. Nevertheless, we crossed our lgl-1::GTA transgenic strain with the lgl-1(tm2616) deletion allele to prevent incorporation of untagged LGL-1 protein into complexes. For let-413, no molecular null allele is available, and the let-413::GTA transgenic strain was crossed with a strain carrying the let-413(s128) missense mutation, which causes lethality during elongation of the developing embryo [40]. While expression of LET-413::GTA restored embryonic viability, this strain still grew slowly. LET-413 purifications where therefore performed in a let-413 wild-type background.

In summary, the five tagged proteins localize to the appropriate subcellular domains, and the two transgenes that we could test in complementation assays rescue the lethality caused by the corresponding mutant alleles. Thus, the experimental design appears well suited for the tagging of proteins of interest, without interfering with their function.

Large-scale culturing and purification of protein complexes

Each of the 20 strains was grown in large-scale liquid culture, starting from semi-synchronized L1 cultures generated by starvation on plates. After growth in liquid culture, animals were harvested when most larvae were at the third or fourth larval stage. All strains were grown and analyzed in triplicate to enhance the possibility of separating bona fide protein–protein interactions from nonspecific interactions. All of the harvested cultures were lysed by sonication, and biotinylated proteins were purified using streptavidin-coated beads. Next, bait proteins and binding partners were released from the streptavidin beads through TEV protease cleavage.

To examine the specificity of the biotinylation by BirA, and the efficiency of the purification and subsequent release by TEV cleavage, we analyzed expression and purification of DLG-1::GTA (Fig. 5). Western blot analysis of biotinylated proteins in whole lysates showed a band of the correct molecular weight in samples expressing DLG-1::GTA and ubiquitous BirA, which was absent from the wild-type N2 control (Fig. 5a). No additional biotinylated bands were detected upon expression of BirA, indicating that BirA specifically biotinylates the Avi-tag. Analysis of beads and eluate after purification with streptavidin beads and TEV cleavage showed that DLG-1::GFP was released from the beads, while endogenously biotinylated proteins remained bound (Fig. 5b). We also analyzed the biotinylation efficiency and recovery by TEV cleavage of GTA::CDC-42. We purified GTA::CDC-42 from a strain expressing BirA in the seam and hyp7 epidermal cells using GFP-Trap beads as well as streptavidin beads (Fig. 5c). The equal levels of recovery (compare lanes 1 and 2) indicate efficient biotinylation of GTA::CDC-42. Analysis of beads and eluate after TEV cleavage of GTA::CDC-42 purified with streptavidin beads indicate efficient TEV cleavage. However, approximately half of the CDC-42 remained bound to the beads, despite having been cleaved by TEV (as indicated by the shift in apparent molecular weight). Thus, the overall efficiency of recovery can vary between bait proteins.

Tissue-specific protein purification recovers known LGL-1 interactors

We next analyzed the samples by high-resolution MS. Each sample was run on a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel for a length of ~1 cm, followed by in-gel digestion with trypsin and liquid chromatography (LC) MS/MS analysis. Raw data are available via ProteomeXchange with identifier PXD002139. To distinguish genuine interacting proteins from nonspecific binding proteins, we analyzed the data using the SAINT tool, which was developed to assign confidence scores to protein–protein interactions identified in AP/MS experiments [41]. Based on label-free quantification data, and taking into account the number of replicates in which a protein is observed, as well as negative control data, SAINT assigns a probability score to each bait–prey pair identified [41]. Scores range from 0 to 1, and interactions scoring >0.8 can be considered to represent high confidence interactions [41]. We analyzed our samples using SAINT Express embedded within the CRAPome online interface [42]. Spectral counts for the triplicate experiments and negative control samples were uploaded and processed using the default settings. The four tissues analyzed (ubiquitous, epidermal, intestine, neuronal) were processed separately. The results are presented in Additional file 4: Table S1 and Additional file 5: Table S2.

The proteins that co-purified with LET-413 appear unlikely to be specifically involved in cell polarity: B0303.3 is a homolog of β-ketothiolase, and QARS-1 is a glutaminyl tRNA synthetase. In contrast, LGL-1 co-purified with PAR-6 and PKC-3. C. elegans LGL-1 was previously found to be associated with PAR-6 and PKC-3 in embryos [39], and Drosophila and mammalian Lgl form a complex with Par-6 and aPKC [29, 32, 33]. In our experiments, PAR-6 and PKC-3 both co-purified with LGL-1 biotinylated specifically in the intestine or seam and hyp7 epidermal cells, as well as with ubiquitously biotinylated LGL-1. These results demonstrate that our biotinylation-based approach is able to identify biologically relevant interactions from specific tissues with high confidence.

Identification of a novel interaction between DLG-1 and the AAA ATPase-family protein ATAD-3

To validate the ability of our approach to identify novel interactors, we focused on the candidate DLG-1 interaction partner ATAD-3, which was identified with high confidence using ubiquitously biotinylated DLG-1::GTA, as well as with lower confidence using BirA expressed in epidermal cells, intestine, and neurons (Table 2). Moreover, ATAD-3 was not identified with any confidence with the other bait proteins (Additional file 5: Table S2). ATAD-3 is an evolutionarily conserved AAA-family ATPase that is essential for mitochondrial activity and development of C. elegans [44]. We verified the ubiquitous nature of the DLG-1/ATAD-3 interaction by immunoprecipitating ATAD-3 and DLG-1 from embryonic lysates using specific antibodies. Purification of ATAD-3 revealed co-immunoprecipitation of DLG-1 at a level that was comparable to that observed after DLG-1 immunoprecipitation (Fig. 6a, compare lane 7 and 4). This suggests that a major fraction of DLG-1 interacts with ATAD-3 in the embryo. Conversely, purification of DLG-1 resulted in the co-immunoprecipitation of only a small amount of ATAD-3 (Fig. 6a, lane 4). Purification of ATAD-3 or DLG-1 from lysates of embryos treated with RNAi directed against dlg-1 or atad-3 failed to co-immunoprecipitate substantial amounts of DLG-1 or ATAD-3. Thus, the co-immunoprecipitation of DLG-1 is dependent on the presence of ATAD-3, and vice versa. Together, these data indicate that DLG-1 specifically interacts with ATAD-3.

DLG-1 contains three PDZ domains, which are known to function as protein interaction modules. Yeast two-hybrid experiments with fragments of DLG-1 revealed that ATAD-3 binds to the second PDZ domain of DLG-1 (Fig. 6b). PDZ domains frequently bind to short C-terminal motifs in interacting proteins, and the final four amino acids of ATAD-3 (ETAV) match a predicted PDZ domain-binding-specificity class [45]. Indeed, removal of the ETAV sequence rendered ATAD-3 incapable of binding to DLG-1 in the yeast two-hybrid system (Fig. 6b). This indicates that ATAD-3 binds with its C-terminal ETAV motif to the second PDZ domain of DLG-1. To investigate whether the ETAV motif is necessary in vivo to mediate the interaction of ATAD-3 with DLG-1, we generated strains expressing full-length ATAD-3 (ATAD-3^FL), or ATAD-3 lacking the C-terminal four amino acids (ATAD^ΔETAV). We inserted single-copy transgenes in chromosome IV by MosSCI [46], and crossed these animals with the atad-3(ok3093) strain to obtain animals expressing only the transgene. Both strains express ATAD-3 at levels comparable to wild type (Fig. 6c and Additional file 7: Figure S4). Co-immunoprecipitation experiments showed that ATAD^FL interacts with DLG-1 in embryos (Fig. 6c). In contrast, truncation of the C-terminal ETAV motif of ATAD-3 completely prevented the DLG-1 interaction in vivo (Fig. 6c). These data strongly support the presence of a direct physical interaction between ATAD-3 and DLG-1, mediated by the second PDZ domain of DLG-1 and the C-terminal ETAV motif of ATAD-3.

Both the ATAD-3^FL and the ATAD^ΔETAV strains are viable. However, ATAD^ΔETAV animals displayed a dramatically reduced fertility compared to wild type, as well as an increase in embryonic lethality (Fig. 6d). This phenotype was exacerbated at 25 °C compared to 15 °C. These findings indicate that the interaction between ATAD-3 and DLG-1 is physiologically relevant.

Identification of a C. elegans MAP1-family member as a candidate neuron-specific DLG-1 interacting protein

Four of the DLG-1 interactors co-purified exclusively with DLG-1::GTA biotinylated in neurons, and may therefore represent proteins that function with DLG-1 specifically in this tissue. BLAST searches with one of these proteins, F32A7.5, identified the MAP1 family of microtubule-associated proteins (MAPs) as the closest homologs of F32A7.5. Mammalian genomes generally encode three MAP1 proteins: MAP1A, MAP1B, and the shorter family member MAP1S. In Drosophila, a single homolog termed Futsch has been described, which shares homology with mammalian MAP1A and MAP1B in the N- and C-terminal regions [47]. Interestingly, MAP1A localizes to postsynaptic densities, and interacts with the DLG-1 homologs DLG1 (SAP-97), DLG2 (PSD-93), and DLG4 (PSD-95) [48, 49]. To date, no C. elegans MAP1-family proteins have been described. We hypothesized that F32A7.5 represents a C. elegans MAP1-family member, and examined this protein in more detail.

MAP1A, MAP1B, and Futsch are large proteins (predicted molecular weights 305 kDa, 270 kDa, and 592 kDa, respectively) with no predicted folded domains and extensive predicted unstructured regions. All three proteins are proteolytically cleaved into a heavy chain and a 26–30 kDa light chain derived from the C-terminus [50]. C. elegans F32A7.5 is smaller (predicted molecular weight before cleavage 92 kDa), but also contains a large predicted unstructured region. Analogous to Futsch, the similarity of F32A7.5 with the mammalian MAP1 proteins was largely limited to the N- and C-terminus (Fig. 7a). Phylogenetic analysis indicated that F32A7.5 is equally related to MAP1A, MAP1B, and MAP1S (Fig. 7b and Additional file 8: Figure S5). The C. elegans genome encodes two other proteins that are highly similar to F32A7.5, termed F25D7.4 and C36A4.5. The high degree of similarity between these proteins (>85 % amino acid identity) indicates that they are paralogs, and in the EggNOG 4.1 database of orthologous groups all three proteins are placed in the same orthologous group as mammalian MAP1A, MAP1B, and MAP1S [51]. Based on phylogeny and the results presented below, we name these proteins MAPH-1.1, MAPH-1.2, and MAPH-1.3, for “microtubule-associated protein 1 homolog 1.”

To examine the expression pattern and subcellular localization of MAPH-1.1, and to validate the interaction with DLG-1, we used CRISPR/Cas9-based genome editing to engineer a GFP-tagged maph-1 locus (GFP::maph-1.1). By western blot, GFP::MAPH-1.1 has an apparent molecular weight of ~60 kDa, much lower than the predicted 119 kDa molecular weight of an unprocessed GFP::MAPH-1.1 fusion (Fig. 7c lane 2). This indicates that, like the mammalian Map1 proteins, MAPH-1.1 is proteolytically cleaved. To confirm the co-affinity purification of MAPH-1.1 with DLG-1, we crossed the GFP::maph-1.1 strain with a strain expressing DLG-1::GTA from its own promoter and BirA from the neuronal rgef-1 promoter. As a control, we crossed the GFP::maph-1.1 strain with a strain ubiquitously expressing cytoplasmic GFP::TEV::Avi, and expressing BirA in neurons. We purified DLG-1::GTA using streptavidin-coated beads, and tested for co-purification of MAPH-1.1 by western blotting using an antibody detecting GFP. We observed co-purification of MAPH-1.1 with DLG-1::GTA, but not with the GFP::TEV::Avi control (Fig. 7c). This confirms the identification of MAPH-1.1 in neuronal DLG-1 purifications by MS.

We observed broad expression of GFP::MAPH-1.1 in multiple somatic postembryonic tissues. This included neurons, but also body wall muscle cells, the vulva, vulval muscle cells, the hypodermis, seam cells, and intestinal cells (Fig. 7d). The fact that we did not identify MAPH-1.1 in DLG-1 purifications from seam or intestinal cells implies that this interaction is either occurring only in neurons, or stabilized in neurons by a neuron-specific protein.

The subcellular localization pattern of GFP::MAPH-1.1 closely resembled that of previously described non-centrosomal microtubule arrays in uterine muscle cells [52], circumferential microtubule arrays in the hypodermis [53], and body wall muscle cells [54] (Fig. 7d). Furthermore, live imaging revealed a highly dynamic behavior of the observed arrays, including shrinkage events (Additional file 9: Movie S1; Additional file 10: Movie S2; Additional file 11: Movie S3; Additional file 12: Movie S4; Additional file 13: Movie S5; and Additional file 14: Movie S6). We measured the shrinkage rate of several arrays in the hypodermis and body wall muscle cells, and obtained an average rate of 0.76 μm/s and 0.85 ± 0.14 μm/s respectively (Additional file 15: Figure S6). These rates are consistent with the previously observed shrinkage rate of 0.85 μm/s for non-centrosomal microtubule bundles in differentiated uterine muscle cells [52]. Finally, we examined the dynamics of GFP::MAPH-1.1 using fluorescence recovery after photobleaching (FRAP). GFP::MAPH-1.1 showed a half-time of recovery of 6 s, which is similar to the rapid dynamics observed for the microtubule-binding domain of ensconsin (MAP7) [55]. All of these observations are consistent with MAPH-1.1 acting as a microtubule-binding protein. Nevertheless, in body wall muscle cells and the hypodermids, tubulin and actin can form bundles that are similar in appearance. Given that mammalian MAP1 proteins can associate with actin [50], we cannot exclude that MAPH-1.1 also localizes to actin structures.

To further confirm the localization of MAPH-1.1 to microtubules, particularly in neurons, we expressed a translational GFP::MAPH-1.1 fusion protein in cultured primary rat hippocampal neurons, in which microtubules are easily visualized. Co-staining with an antibody directed against α-tubulin showed clear co-localization of MAPH-1.1 with microtubules in the neuronal cell body, axon, and dendrites (Fig. 7e). We also expressed a DLG-1:: mCherry fusion protein in cultured hippocampal neurons, and observed localization to synaptic structures in dendrites (Fig. 7f). We conclude that, like mammalian MAP1A, MAPH-1.1 is a microtubule-associated protein, and a candidate neuron-specific interaction partner of DLG-1. In contrast to MAP1A, however, maph-1.1 is broadly, if not ubiquitously, expressed.

Cloning of GTA tags

To generate the N- and C-terminal GTA tag constructs pMB41 and pMB72, we inserted TEV and Avi sequences obtained as synthetic DNA constructs from GenScript (http://www.genscript.com), and codon-optimized GFP/GalK sequences from vector pBALU1 [26] into vector pUC19 (NEB, http://www.neb.com) by Gibson assembly. Vector maps and sequences are available in Additional file 16. pMB41 and pMB72 are available through Addgene (see “Availability of data and materials” below).

Recombineering

The recombineering approach we used has been described previously [26]. Briefly, the fosmid to be engineered is transformed into E. coli strain SW105, a galK-defective strain carrying a heat shock-inducible phage λ Red recombinase, and an arabinose-inducible Flp recombinase. Bacteria carrying the fosmid are transformed with a PCR product consisting of the tag to be introduced, which also carries the wild-type galK sequence, flanked on both sides by 50 nucleotides identical to the insertion site. Expression of λ Red induces homologous recombination between the fosmid and the PCR product, and successful recombinants are selected on media with galactose as the only carbon source. Finally, galK sequences, which are flanked by FRT sites, are eliminated from the fosmid by expression of the Flp recombinase.

We used the following fosmids and primers to generate the PCR products used as templates for homologous recombination: For tagging dlg-1 we used the C-terminal tag, fosmid WRM067dB05, and primers rec_dlg-1_C-term_F (5′-actccatcatcagccgtgaatcgcagacgccaatttgggtgccacgtcatggaggaggatctggaggaggaggatctggaggagga) and rec_dlg-1_C-term_R (5′-acatatttcttgaagaaacgattatttgtctaaaaaatatccaatttcatctattcatgccattcaatcttctgagcttcg); for let-413 the C-terminal tag, fosmid WRM0640dF02, and primers rec_let-413_C-term_F (5′-ggtccccatcgccagtttcgagaacatctgtgagtaggccatgtgagtatggaggaggatctggaggaggaggatctggaggagga) and rec_let-413_C-term_R (5′-gaatgtcaaaaaaaaaacgtctaatgtctagttttcagccaaaatcggcctcattcatgccattcaatcttctgagcttcg); for lgl-1 the C-terminal tag, fosmid WRM065bB11, and primers rec_lgl-1_C-term_F (5′-gaagtacggtgaatttgaactttcgcggttggagcagtacgcacaagtcaggaggaggatctggaggaggaggatctggaggagga) and rec_lgl-1_C-term_R (5′-aaaattaatatatatcaacaggaaaacgatttttaaaaaaaatgcatctattcatgccattcaatcttctgagcttcg); for par-3 the C-terminal tag, fosmid WRM064bG02, and primers rec_par-3_C-term_F (5′-gccaataccgtcgcagagatcagggaccgcctcatcgttttccccagtacggaggaggatctggaggaggaggatctggaggagga) and rec_par-3_C-term_R (5′-gattccgtatttttcgcggctgcgtaatataactttgagaaaaaactgacctattcatgccattcaatcttctgagcttcg); and for cdc-42 the N-terminal tag, fosmid WRM0612bG08, and primers rec_cdc-42_N-term_F (5′-ctataaagacgtaattttaatacttttattcattttttttttcaggcgaaaaaaatgggacttaatgatattttcgaagctcag) and rec_cdc-42_N-term_R (5′-gttttaccgacagctccatctccaacgacgacgcacttgatcgtctgcatacctcctcctccagatcctcctcct). To check whether the recombineering procedure was successful we performed a PCR reaction on the constructs with primers rec_dlg-1_C-term_check_F (5′-aagctcaagcgcagtattcc) and rec_dlg-1_C-term_check_R (5′-tttcttgaattgagaacttggaaa) for dlg-1, primers rec_let-413_C-term_check_F (5′-cgattggtattccgattggt) and rec_let-413_C-term_check_R (5′-gccgaacagtaacggagatt) for let-413, primers rec_lgl-1_C-term_check_F (5′-gggagttatgtacaggcatctagta) and rec_lgl-1_C-term_check_R (5′-taagccagccgctagcac) for lgl-1, primers rec_par-3_C-term_check_F (5′-tatgccgcgaaggagaagta) and rec_par-3_C-term_check_R (5′-ttcgctcagcggaattatc) for par-3, and primers rec_cdc-42_N-term_check_F (5′-tcgtttattaaggcgtttaccg) and rec_cdc-42_N-term_check_R (5′-cgatcgtaatcttcctgtcc) for cdc-42.

Cloning the BirA constructs

The C. elegans codon-optimized BirA sequence was obtained as a synthetic DNA construct from GenScript (http://www.genscript.com). To generate the BirA expression constructs pMB37 (Prps-27::BirA), pMB71 (Pelt-2::BirA), and pMB73 (Pwrt-2::BirA), the BirA sequence was cloned into vector pPD158.87 (Addgene #1709) using KpnI and EcoRI restriction sites. For vector pBT331 (Prgef-1∷BirA), the BirA sequence was cloned into vector backbone pPD95.77 (Addgene plasmid #1495) using KpnI and EcoRI. Next, promoter regions were amplified from C. elegans genomic DNA and cloned into appropriate restriction sites. For pMB37, the rps-27 promoter was amplified using primers Prps-27F (5′-aaa CTGCAGttcaatcggtttttccttgcttgc) and Prps-27R (5′-aaaGGTACCattccacttgttgagcggggctg), and cloned using PstI/KpnI. For pMB71, the elt-2 promoter was amplified using primers Pelt-2F (5′-aaaCTGCAGtaatttcgaaatgtatgaactccaattc) and Pelt-2R (5′-aaaCCCGGGctataatctattttctagtttc), and cloned using PstI/SmaI. For pMB73, the wrt-2 promoter was amplified using primers Pwrt-2F (5′-aaaCTGCAGcaggtcgactccacgtaatttc) and Pwrt-2R (5′-aaaCCCGGGGATCCccgagaaacaattggcaggttg), and cloned using PstI/SmaI. For pBT331, the rgef-1 promoter was amplified using primers Prgef-1F (5′- aaaCTGCAGcgtttccgatacccccttatatc) and Prgef-1R (5′-aaaCCCGGGgatcctttactgctgatcgtcg), and cloned using PstI/SmaI. Vector maps and sequences are available in Additional file 16. The BirA expression constructs are available through Addgene (see “Availability of data and materials” below).

Cloning the control constructs

To generate expression constructs pMB43 (Prps-27::GTA), pMB76 (Pelt-2::GTA), and pMB77 (Pwrt-2::GTA), we first removed the GalK sequences from the GTA tag vector pMB71 by expression of Flp recombinase. The resulting GFP-2xTEV-Avi sequence was then amplified using primers GTA_F (5′-aaaGGTACCggtagaaaaaatgagtaaaggagaagaacttttc) and GTA_R (5′-aaaGCTAGCttattcatgccattcaatcttctgag), and cloned into vector pPD158.87 (Addgene #1709) using KpnI and NheI. Next, promoter regions were amplified from C. elegans genomic DNA and cloned into appropriate restriction sites. For pMB43, the rps-27 promoter was amplified using primers Prps-27F (5′-aaaCTGCAGttcaatcggtttttccttgcttgc) and Prps-27R (5′-aaaGGTACCattccacttgttgagcggggctg), and cloned using PstI/KpnI. For pMB76, the elt-2 promoter was amplified using primers Pelt-2F (5′-aaaCTGCAGtaatttcgaaatgtatgaactccaattc) and Pelt-2R (5′-aaaCCCGGGctataatctattttctagtttc), and cloned using PstI/SmaI. For pMB77, the wrt-2 promoter was amplified using primers Pwrt-2F (5′-aaaCTGCAGcaggtcgactccacgtaatttc) and Pwrt-2R (5′-aaaCCCGGGGATCCccgagaaacaattggcaggttg), and cloned using PstI/SmaI. For pMB43, the let-858 3′-UTR was replaced with the tbb-2 3′-UTR by PCR amplifying the tbb-2 3′-UTR with primers tbb-2U_F (5′-aaaGCTAGCatgcaagatcctttcaagc) and tbb-2U_R (5′-aaaGGGCCCtgatccacgatctggaagatttc), and cloning using NheI and ApaI restriction sites. Vector maps and sequences are available in Additional file 16.

C. elegans strains and culture conditions

Unless otherwise indicated, strains were maintained at 15 °C as previously described [73]. Transgenic strains were generated by injecting constructs into the gonad of young adult N2 animals using conventional micro-injection procedures. N2 animals were obtained from the Caenorhabditis Genetics Center. The amounts of each construct injected are indicated for each strain, and were supplemented to a final DNA concentration of 80 ng/μl with PstI digested phage λ DNA. The resulting transgenic strains carrying extrachromosomal arrays were subjected to gamma irradiation to integrate the construct into the C. elegans genome. The following strains were generated:

BAT5: barIs3 [Prgef-1::BirA, Pceh-36::mCherry] X

BOX20: mibIs7[Pwrt-2::BirA 10 ng/μl + Pmyo-2::mCherry 2.5 ng/μl]II

BOX27: mibIs14[Pelt-2::BirA 10 ng/μl + Pmyo-2::mCherry 2.5 ng/μl]I

BOX41: mibIs23[lgl-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V

BOX43: mibIs25[Avi-2xTEV-GFP::cdc-42 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]X

BOX51: mibIs26[par-3::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V

BOX55: mibIs30[let-413::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]X

BOX56: mibIs31[dlg-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V

BOX58: mibIs33[Prps-27::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I

BOX60: mibIs35 [Prgef-1::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl] II

BOX61: mibIs36[Pwrt-2::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]X

BOX62: mibIs37[Pelt-2::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]X

BOX65: mibIs40[Prps-27::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]III

BOX99: mibIs14[Pelt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs37[Pelt-2::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]X

BOX100: mibIs7[Pwrt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]II; mibIs37[Pelt-2::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]X

BOX101: mibIs14[Pelt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs36[Pwrt-2::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]X

BOX102: mibIs7[Pwrt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]II; mibIs36[Pwrt-2::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]X

BOX103: mibIs33[Prps-27::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs26[par-3::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V

BOX104: mibIs7[Pwrt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]II; mibIs26[par-3::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V

BOX105: mibIs14[Pelt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs26[par-3::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V

BOX106: mibIs33[Prps-27::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs31[dlg-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V; dlg-1(ok318)X

BOX107: mibIs7[Pwrt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]II; mibIs31[dlg-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V; dlg-1(ok318)X

BOX108: mibIs14[Pelt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs31[dlg-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V; dlg-1(ok318)X

BOX109: mibIs35 [Prgef-1::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl] II; mibIs31 [dlg-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 10 ng/μl] V ; dlg-1(ok318) X

BOX110: mibIs33[Prps-27::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs30[let-413::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]X

BOX111: mibIs7[Pwrt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]II; mibIs30[let-413::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]X

BOX112: mibIs14[Pelt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs30[let-413::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]X

BOX113: mibIs33[Prps-27::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs23[lgl-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V; lgl-1(tm2616)X

BOX114: mibIs7[Pwrt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]II; mibIs23[lgl-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V; lgl-1(tm2616)X

BOX115: mibIs14[Pelt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs23[lgl-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 5 ng/μl]V; lgl-1(tm2616)X

BOX116: mibIs40[Prps-27::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]III; mibIs33[Prps-27::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I

BOX117: mibIs7[Pwrt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]II; mibIs40[Prps-27::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]III

BOX118: mibIs14[Pelt-2::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl]I; mibIs40[Prps-27::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl]III

BOX119: mibIs35 [Prgef-1::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl] II; mibIs40 [Prps-27::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl] III

BOX133: mibIs7 [Pwrt-2::BirA 10 ng/μl, Pmyo-2::mCherry] II; mibIs25 [cdc-42::GFP-2TEV-Avi 10 ng/μl, Pmyo-3::mCherry 10ngμl] X

BOX134: mibIs33 [Prps-27::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl] I; mibIs25 [cdc-42::GFP-2TEV-Avi 10 ng/μl, Pmyo-3::mCherry 10 ng/μl] X

BOX135: mibIs14 [Pelt-2::BirA 10 ng/μl, Pmyo-2::mCherry 10 ng/μl] I; mibIs25 [cdc-42::GFP-2TEV-Avi 10 ng/μl, Pmyo-3::mCherry 10 ng/μl] X

BOX188: maph-1.1(mib12[GFP::maph-1.1]) I

BOX209: maph-1.1(mib12[GFP::maph-1.1]) I; mibIs35 [Prgef-1::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl] II; mibIs40 [Prps-27::GFP-2xTEV-Avi 10 ng/μl, Prab-3::mCherry 5 ng/μl] III

BOX212: maph-1.1(mib12[GFP::maph-1.1]) I; mibIs35 [Prgef-1::BirA 10 ng/μl, Pmyo-2::mCherry 2.5 ng/μl] II; mibIs31 [dlg-1::GFP-2xTEV-Avi 10 ng/μl, Pmyo-3::mCherry 10 ng/μl] V

SV1311: atad-3(ok3093) II; hels97[Patad-3::ATAD-3, cb unc-119] IV (referred to as ATAD-3^FL)

SV1312: atad-3(ok3093) II; hels98[atad-3::ATAD-3-ETAV, cb unc-119] IV (referred to as ATAD-3^ΔETAV).

Western blot analysis

Protein samples were separated on 10 % acrylamide gels, and subjected to western blotting on polyvinylidene difluoride membrane (Immobilon-P; Millipore). Blots were blocked with 5 % skim milk in phosphate-buffered saline with Tween (PBST; 7 mM Na₂HPO₄, 3 mM NaH₂PO₄, 140 mM NaCl, 5 mM KCl, 0.05 % Tween-20) for 1 h at room temperature. For detection of GFP, blots were incubated with rabbit polyclonal anti-GFP (Abcam ab6556, 1:1000) or anti-biotin (Abcam ab1227, 1:1000) in PBST + 5 % skim milk for 1 h at room temperature, washed with PBST three times for 10 min each at room temperature, incubated with anti-rabbit IgG antibody conjugated to horseradish peroxidase (Jackson Immuno Research 111035003, 1:10,000) for 45 min at room temperature, washed with PBST three times for 10 min each at room temperature, and finally washed once with PBS at room temperature for 10 min. Blots were developed using enhanced chemiluminescent western blotting substrate (Bio-Rad Laboratories).

C. elegans liquid culture

Liquid cultures were started with semi-synchronized L1 animals obtained by starvation. Depending on the growth rate of the transgenic strain to be cultured, 20–60 9 cm nematode growth media (NGM) plates with OP50 bacteria were seeded with 15–45 L4 animals per plate. After 6 or 7 days at 20 °C, no bacteria were left on the plates and the plates were covered with starved L1 animals. All animals were washed off the plates and transferred to a 2 l Erlenmeyer flask containing 500 ml S-medium supplemented with penicillin-streptomycin (5000 U/ml, Life Technologies 15070-63) diluted 1:100, and nystatin suspension (10,000 U/ml, Sigma N1638) diluted 1:1000 [74]. A pellet of OP50 E. coli bacteria obtained from a 0.5 l overnight culture in lysogeny broth (LB) was added as food source. Animals were allowed to develop until the L3/L4 stage in an incubator at 20 °C shaking at 200 rpm. To harvest the animals, the culture was transferred to 50 ml conical tubes and cooled on ice for 20 min. Animals were then pelleted by centrifugation (all centrifugation steps in this protocol were performed at 400 g for 2 min at 4 °C). After aspirating the supernatant, animals were pooled in a single 50 ml tube, and washed twice in ice-cold M9 lacking MgSO₄ [74]. After the second wash step, animals were resuspended in 20 ml of ice-cold M9 lacking MgSO₄, followed by the addition of 20 ml of ice-cold 60 % sucrose in H₂O. After vigorous mixing of the sucrose/worm mixture, 4 ml of ice-cold M9 lacking MgSO₄ was gently layered on top, and the worms were centrifuged at 400 g for 2 min at 4 °C. A layer of animals was now visible on top of the sucrose, while contaminants sedimented at the bottom. The sucrose float steps were performed as quickly as possible, as otherwise the layer of animals failed to form properly. To maximize recovery, 30 ml of supernatant was aspirated from the sucrose float, and distributed into four 50 ml tubes that were subsequently filled by addition of room-temperature M9 lacking MgSO₄. The room temperature M9 allowed the animals to digest OP50 bacteria in their intestine. The four tubes were placed on ice to cool down for 30 min, after which the animals were washed twice in lysis buffer (150 mM NaCl, 20 mM Tris pH 7.8, 5 mM EDTA). During the first wash the animals were again pooled into one tube. After a final wash in lysis buffer supplemented with 1 % Triton X-100, as much lysis buffer as possible was removed, and the C. elegans pellet was frozen in liquid nitrogen and stored at −80 °C.

Lysis

C. elegans pellets were lysed by sonication using a Diagenode Bioruptor (http://www.diagenode.com) fitted with a 15 ml tube holder. To each frozen pellet was added 5 ml of lysis buffer (150 mM NaCl, 20 mM Tris pH 7.8, 5 mM EDTA) supplemented with 1 % Triton X-100, 0.5 tablet of protease inhibitor (Roche, 05892791001), and 7 μl of β-mercaptoethanol. Pellets were gently swirled until thawed. Lysates were transferred to 15 ml TPX hard plastic tubes and placed in the Bioruptor filled with ice-water. Samples were lysed nine times for 30 s, with 30 s intervals. After the third and sixth lysis period, lysates were mixed by gently swirling the tube. To remove cellular debris, lysates were distributed to 2 ml Eppendorf tubes, centrifuged at 16,000 g for 15 min at 4 °C, and collected in a fresh conical-bottom 15 ml polypropylene tube. The concentration of protein in the lysates was determined by Bradford assay (Bio-Rad Laboratories) and the lysates were diluted to 1 mg protein/1 ml lysate.

Affinity purification

Affinity purifications were performed with streptavidin-coated beads (Chromotek, HP57.1). Prior to use, beads were washed twice in lysis buffer (150 mM NaCl, 20 mM Tris pH 7.8, 5 mM EDTA) supplemented with 1 % Triton X-100 in a 1.5 ml Eppendorf tube, pelleting the beads by centrifugation at 7500 g for 30 s. After the final wash, beads were resuspended in lysis buffer, in the original volume. Next, 25 μl of beads were added to 15 ml of lysate (15 mg protein) in a 15 ml conical-bottom polypropylene tube, after which the tubes were rotated at 4 °C for 1.5 h. Following the incubation, beads were pelleted by centrifugation at 3220 g for 5 min at 4 °C, resuspended in 0.5 ml TEV buffer (20 mM Tris pH 8.0, 150 mM NaCl, and 0.3 % NP40), and transferred to an Eppendorf tube. Beads were then washed three times with 500 μl TEV buffer, pelleting the beads by centrifugation at 7500 g for 30 s at 4 °C. Finally, the beads were resuspended in 15 μl TEV buffer and 2 μl of TEV protease (Promega, V6101) was added to the samples. TEV cleavage was performed overnight at 4 °C in a shaking block for Eppendorf tubes, shaking at 800 rpm.

Mass spectrometry

Protein reduction and alkylation was performed with 10 mM dithiothreitol (56 °C for 1 h) and 50 mM 2-chloro-iodoacetamide (30 min at room temperature in the dark), respectively, after which in-gel digestion was performed with trypsin overnight at 37 °C. Peptides were extracted with 100 % acetonitrile. The samples were analyzed on an LTQ Orbitrap Elite (Thermo Scientific, Bremen) connected to a Proxeon UHPLC system (Thermo Scientific, Odense). The nanoLC was equipped with a 20 mm × 100 μm internal diameter Reprosil C18 trap column and a 400 mm × 50 μm internal diameter Poroshell C18 analytical column (Zorbax, Agilent), all packed in-house. Solvent A consisted of 0.1 M acetic acid (Merck) in deionized water (Milli-Q, Millipore), and solvent B consisted of 0.1 M acetic acid in 80 % acetonitrile (Biosolve). Trapping was performed at a flow of 5 μl/min for 10 min and the fractions were eluted using a flow rate of 150 nl/min (120 min LC method). The mass spectrometer was operated in positive ion mode and in data-dependent mode to automatically switch between MS and MS/MS. The three most intense ions in the survey scan (350–1500 m/z, resolution 60,000, AGC target 1e6) were fragmented with higher energy collisional dissociation (HCD; AGC target 6e4), with the normalized collision energy set to 32 %. The signal threshold for triggering an MS/MS event was set to 500 counts. Charge state screening was enabled, and precursors with unknown charge state or a charge state of 1 were excluded. Dynamic exclusion was enabled (exclusion size list 500, exclusion duration 40 s).

Mass spectrometry data analysis

Peak lists were generated from the raw data files using Proteome Discoverer version 1.4.1.14 (Thermo Scientific, Bremen). For each affinity purification, one peak list was generated per gel lane. Peak lists were searched against a C. elegans database (UniProt, Jan 2014, 25,863 entries) supplemented with frequently observed contaminants using Mascot software version 2.4.01 (Matrix Science, UK). Trypsin was chosen with two missed cleavages allowed. Carbamidomethylation (C) was set as a fixed modification and oxidation (M) was set as variable modification. The searches were performed using a peptide mass tolerance of 50 ppm and a product ion tolerance of 0.05 Da (HCD), followed by data filtering using percolator, resulting in 1 % false discovery rate (FDR). Only ranked 1 peptide spectrum matches with Mascot scores >20 were accepted. The spectral counts for each triplicate of controls and the four tissues were uploaded to the CRAPome online interface version 1.1 [42] for statistical validation.

Lysis and immunoprecipitations for DLG-1/ATAD-3

Strains were grown in S-medium, either containing HB101 bacteria or bacterial feeding strains targeting dlg-1, atad-3, or gfp (control) to induce RNAi. Embryo pellets were obtained by hypochlorite treatment of adult worms. Embryo pellets were ground two times for 30 s at a frequency of 1500 beats/min using a Mikro-Dismembrator (Sartorius). Ground embryo pellets were lysed in lysis buffer [20 mM Tris-HCl pH 7.8, 250 mM NaCl, 15 % glycerol, 1 % Triton X-100, 0.5 mM EDTA, 1 mM β-mercaptoethanol, 10 mM 1-naphthyl phosphate monosodium salt monohydrate, 50 mM sodium fluoride, 10 mM sodium pyrophosphate decahydrate, 100 μM sodium orthovanadate, and protease inhibitors (Roche complete, Mini, EDTA-free)] for 15 min at 4 °C. The lysate was cleared at 13,000 rpm for 15 min at 4 °C. For immunoprecipitations, 1 mg of total protein was used with either 1 μl mouse anti-PSD95 antibody (Abcam ab2723, RRID AB_303248) non-covalently bound to 5 μl protein G Sepharose beads, 1 μl rabbit anti-ATAD-3 antibody [44] non-covalently bound to 7.5 μl protein A Sepharose beads, 2 μl rabbit anti-GFP antibody (ThermoFisher A-11122, RRID AB_10073917) non-covalently bound to 7.5 μl protein A Sepharose beads (negative control), or 2 μl rabbit anti-eIF4E antibodies [75] non-covalently bound to 7.5 μl protein A Sepharose beads (negative control). Immunoprecipitations were performed for 1 h at 4 °C. Input lysates (1/25) and immunoprecipitations were loaded on gel. Standard procedures were used for SDS-PAGE and western blotting. Mouse anti-PSD95 (1:1000) and rabbit anti-ATAD-3 (1:500) were used for detection. Horseradish peroxidase-conjugated protein A (VWR International) was used at 1:5000 for ATAD-3 probed blots. The signal was revealed with chemiluminesence (Bio-Rad Laboratories). To examine protein levels in ATAD-3^FL, and ATAD-3^ΔETAV strains, 40 L4 staged larvae grown at indicated temperatures were collected and boiled for 5 min in 1 × Laemmli sample buffer. Samples were run on an SDS-PAGE gel, and blotted according to standard procedures. Immunoblots were probed with rabbit anti-ATAD-3 (1:500) and mouse anti-actin (1:1000) (MP Biomedicals).

Immunoprecipitations for DLG-1/MAPH-1.1

Animals were grown and lysed, and GTA-tagged proteins were purified as described above for the MS experiments. Input lysates (1/100) and immunoprecipitations were loaded on gel. Standard procedures were used for SDS-PAGE and western blotting. For detection of GFP, blots were incubated with rabbit polyclonal anti-GFP (Abcam ab6556, 1:1000) in PBST + 5 % skim milk for 1 h at room temperature, washed with PBST three times for 10 min at room temperature, incubated with anti-rabbit IgG antibody conjugated to horseradish peroxidase (Jackson Immuno Research 111035003, 1:10,000) for 45 min at room temperature, washed with PBST three times for 10 min at room temperature, and finally washed once with PBS at room temperature for 10 min.

Yeast two-hybrid assays

To generate DB::DLG-1 and DB::BAZ fusions, relative fragments were PCR amplified with primers containing EcoRI and BamHI restriction sites in their tails, and cloned into vector pGBTK7 (Clontech, Palo Alto, CA, USA). The following primers were used: PDZ1_F (5′-agGAATTCgtcttggagaaaggtcac), PDZ1_R (5′-tggtggGGATCCcggagccgatgg), PDZ2_F (5′-tccatcgGAATTCattcatccacc), PDZ2_R (5′-tcccatGGATCCgcggttgtag), PDZ3_F (5′-gactacGAATTCtctcaaatgg), PDZ3_R (5′-atGGATCCctcttgtggtctgtactg), BAZ_PDZ1-3_F (5′-tgGAATTCgagagcaagcgaaaggagccc), and BAZ_PDZ1-3_R (5′-gcGGATCCcaagatcttgcggcctaccagc).

To generate AD∷ATAD-3 aa388-595 and AD::ATAD-3 aa388-591 (ΔETAV) fusions, relative fragments were PCR amplified with primers containing BamHI and XhoI restriction sites in their tails, and cloned into vector pACT2 (Clontech). The following primers were used: ATAD-3_F (5′-tcggcGGATCCcaattcataaag), ATAD-3_R595 (5′-taaacCTCGAGttaaacagcagtttctctcttc), and ATAD-3_R591 (5′-taaacCTCGAGttatctcttcaacgta). DB and AD plasmids were co-transformed into yeast strain Y190 (Clontech) using the LiAc transformation method [76]. For X-gal assays, yeast were grown overnight at 30 °C on a nitrocellulose filter on top of a yeast extract peptone dextrose (YEPD) agar plate. A Whatman filter paper was placed in a petri dish containing 2 ml of Z-buffer (60 mM Na₂HPO₄, 40 M NaH₂PO₄, 10 M KCl, 1 M MgSO₄, pH 7), 5.4 μl β-mercaptoethanol, and 33.4 μl X-Gal (stock solution 20 mg/ml in N,N-dimethyl formamide). The nitrocellulose filter with yeast was then fixed in liquid nitrogen for 10 s, thawed at room temperature, and placed on the Whatman filter paper for 30 min at 30 °C.

Generation of atad-3 transgenic strains

For MosSCI integration of atad-3 constructs on chromosome IV, we generated Patad-3::atad-3::atad-3 3′UTR and Patad-3::atad-3ΔETAV::atad-3 3′UTR constructs, and cloned these into the pCFJ1178 vector (a gift from E. Jorgensen, HHMI, University of Utah, USA). For Patad-3 we used a 1050 bp 5′ region of atad-3. As a 3′ UTR we used a 300 bp flanking region of atad-3. Patad-3::atad-3-ETAV::atad-3 3′UTR lacked 12 bp at the 3′-end of the coding region. MosSCI integration was performed as previously described [46, 77]. Briefly: the following injection mixture was injected into unc-119 animals: 10 ng/μl targeting vector, 10 ng/μl pCFJ601 (Peft-3:Mos1 transposase), 2.5 ng/μl pCFJ90 (Pmyo-2:mCherry:unc-54 UTR), and 10 ng/μl pGH8 (Prab-3:mCherry:unc-54 UTR), and wild-type non-fluorescent animals were selected from the F2 progeny.

Progeny counting and scoring of embryonic lethality

Starting at the L4 stage, individual animals were cultured at 15 °C or 25 °C and transferred to a fresh plate every 24 h. Hatched and unhatched progeny were counted 24 h after removal of the P0. Bars in Fig. 6 represent mean values, and error bars the standard deviation. The progeny of four animals was counted for each genotype and temperature.

Phylogenetic analysis and protein alignments

To identify proteins related to MAPH-1.1, MAPH-1.2, and MAPH-1.3, we performed an iterative JackHMMER search with each of the three proteins against the Reference Proteomes dataset (three iterations). To generate the phylogenetic tree, we selected MAP1 homologs from a subset of species. These sequences were aligned using the online version of MAFFT with the settings E-INS-i iterative refinement method (http://mafft.cbrc.jp/alignment/server/) [78]. From the aligned sequences, a phylogenetic tree was produced using FastTree 2 with the default settings [79]. The online Interactive Tree of Life tool was used to visualize the phylogenetic tree (http://itol.embl.de/) [80]. To calculate similarity of MAPH-1.1 to human MAP1S and Drosophila Futsch, we performed pairwise alignments with MAFFT as described above, and calculated protein similarity using the online Sequence Manipulation Suite (http://www.bioinformatics.org/sms2/ident_sim.html) [81].

Genome engineering of GFP::maph-1.1

To engineer the GFP::maph-1 locus, we used homology directed repair of a CRISPR/Cas9 induced double strand break (DSB). To increase the efficiency of DSB generation we generated a new subgenomic RNA (sgRNA) expression vector (pJJR50) that contains the A-U flipped and hairpin extended sgRNA sequence described in Chen et al. [82], under control of the R07E5.16 U6 promoter [83]. Target sequences are cloned into BbsI digested vector as pairs of annealed oligonucleotides with a 5′-TCTT overhang added to the forward oligo, and a 5′-AAAC overhang added to the reverse oligo. The maph-1.1 sgRNA target sequence was GCGTGCATCTACGTCTTGGG, and oligos used to insert the sequence into pJJR50 were 5′- tcttGCGTGCATCTACGTCTTGGG and 5′- aaacCCCAAGACGTAGATGCACGC. To generate the repair template, we inserted 450–650 bp sequences flanking the start codon of maph-1.1 into the self-excising selection cassette vector pDD282 as described [84]. Several mutations were introduced into the sgRNA target site to prevent cutting by Cas9 after repair. The following mixture was injected into 20 N2 adults: 50 ng/ml Peft-3::Cas9 (Addgene #46168) [85], 100 ng/ml sgRNA in pJJR50, 20 ng/ml maph-1.1 repair template, and 2.5 ng/ml pCFJ90 [46]. Injected animals were placed on individual NGM plates. After 2–3 days at 25 °C, 500 μl of 5 mg/ml hygromycin in water was added to each plate, and healthy non-red-fluorescent Rol animals were selected after 3–5 days. To eliminate the marker cassette, 8–16 L2 animal were heat shocked for 4 h at 34 °C, and non-Rol progeny were selected. We obtained two independent lines, both of which displayed the same expression pattern. Vector maps and sequences are available in Additional file 16.

Expression in hippocampal neurons and fixation

To express MAPH-1.1 and DLG-1 in hippocampal neurons, we generated constructs consisting of MAPH-1.1 N-terminally tagged with GFP, and DLG-1 C-terminally tagged with mCherry, driven by the βactin promoter. MAPH-1.1 and DLG-1 were PCR amplified from a mixed-stage C. elegans cDNA library, and inserted into a vector containing the pβactin promoter and GFP or mCherry [86]. MAPH-1.1 was amplified using primers 5′-aaaGGCGCGCCAatgccggaggaatatatcatg and 5′-tttGCGGCCGCttagagcaaatcgactctggcc, and cloned using AscI and NotI. DLG-1 was amplified using primers 5′-aaaAAGCTTatgtcccacgagtcatcgg and 5′-tttGGTCTCGTCGACttatgacgtggcacccaaattggcg, digested with HindIII and BsaI, and ligated into vector digested with HindIII and SalI. Vector maps and sequences are available in Additional file 16. Primary hippocampal neurons prepared from embryonic day 18 rat brains [86] were transfected at 4 days in vitro (DIV4) for MAPH-1 and microtubule imaging, or DIV22 for DLG-1 imaging, using Lipofectamine 2000 (Life Technologies) and cultured for 2 additional days. For microtubule imaging, cells were first extracted with 0.3 % glutaraldehyde (GA) in PEM80-buffer (80 mM PIPES, 1 mM EGTA, 4 mM MgCl₂, pH 6.9) for 1 min at 37 °C. Next, fixation was performed in 4 % paraformaldehyde (PFA) for 10 min. Subsequently, cells were washed twice for 5 min in PBS (Lonza BE17-517Q, w/o Ca and Mg) and cells were further permeabilized for 10 min in PBS + 0.2 % Triton-X100. Cells were then washed three times for 5 min in PBS and incubated for 45 min in blocking solution (2 % w/v bovine serum albumin [BSA], 0.2 % w/v gelatin, 10 mM glycine, 50 mM NH₄Cl in PBS, pH 7.4). Primary antibodies to α-tubulin (Sigma, mouse clone B-5-1-2, 1:800) and MAP2 (Abcam ab5392, chicken, 1:1000) were incubated overnight at 4 °C in blocking solution. Cells were washed three times in PBS and incubated with secondary antibodies anti-Mouse Alexa Fluor568 (Life Technologies, goat, 1:800) and anti-Chicken Alexa Fluor647 (Life Technologies, goat, 1:800) for 1.5 h at room temperature. Finally, cells were washed three times in PBS and mounted in Mowiol 4-88 (Sigma-Aldrich). For imaging of postsynaptic densities, fixation (without prior extraction) was performed in 4 % PFA for 10 min. Subsequently, cells were washed three times for 10 min in PBS (Lonza BE17-517Q, w/o Ca and Mg), and mounted in Mowiol 4-88.

Microscopy and image processing

Still images of live animals were captured on a spinning disc platform consisting of a Nikon Ti-U inverted microscope with a motorized XY stage and a Piezo Z stage, ×60 and × 100 PLAN APO 1.4 numerical aperture (NA) oil objectives, a Yokogawa CSU-X1 spinning disc unit equipped with a dual dichroic mirror set for laser wavelengths 488 nm and 561 nm, 488 nm and 561 nm solid state 50 mW lasers controlled by an Andor revolution 500 series AOTF Laser modulator and combiner, Semrock 512/23 + 630/91 dual band pass emission filter, Semrock 525/30 single band pass emission filter, Semrock 617/73 single band pass filter, Semrock 4800 long pass filter (500–1200 pass), and an Andor iXON DU-885 monochrome EMCCD+ camera. All components were controlled by MetaMorph Microscopy Automation & Image Analysis Software. Live imaging was performed on a Nikon Eclipse-Ti microscope with a Plan Apo VC, ×60, 1.40 NA oil objective (Nikon). The microscope was equipped with an ASI motorized stage MS-2000-XYZ with Piezo Top Plate and a Perfect Focus System (Nikon), and used MetaMorph 7.8 to control the camera and all motorized parts. Confocal excitation and detection was achieved using a 100 mW Cobolt Calypso laser, Yokogawa spinning disc confocal scanning unit (CSU-X1-A1), a GFP emission filter [ET-GFP (49002); Chroma], and a Photometrics Evolve 512 EMCCD camera at a final magnification of 110 nm per pixel, including an additional magnification introduced by an extra intermediate lens 2.0X (Edmund Optics). For FRAP experiments we used a similar microscope setup equipped with an ILas system (Roper Scientific France/PICT-IBiSA, Institut Curie), with the laser set at 100 % laser power and a Plan Apo × 60 NA 1.40 oil lens. Imaging was performed at 1 or 2 frames per second. Microscopy of fixed samples was performed on a Zeiss LSM700 laser scanning confocal microscope equipped with a × 63 Plan-Apochromat 1.4 NA objective; 405 nm, 488 nm, 555 nm, and 633 nm lasers; and the following emission filters: SP490 (400–490 nm), SP555 (400–555 nm), SP640 (400–640 nm), BP490-555 (490–555 nm), LP560 (560–750 nm), LP640 (640–750 nm), and BP592-662 (592–662 nm). The LSM700 was controlled by the Zen software package. Maximum projections were generated from a series of slices of a Z-stack with ImageJ and processed with Adobe Photoshop CS6 and Adobe Illustrator CS6.

FRAP analysis

Images were processed and analyzed in ImageJ. For the FRAP analysis, the average gray value of a 100 × 10 pixel region in the FRAP region or a similar non-bleach area was calculated and background subtracted frame-by-frame by subtracting the average intensity of an empty, non-bleached area. FRAP recovery was calculated as the recovery from the first frame after bleach (set to 0) normalized to the average of the five frames before bleach.

Microtubule depolymerization speed measurement

Microtubule depolymerization speeds were calculated by making kymographs of the acquired movies using the KymoResliceWide plugin in ImageJ and measuring the distance and time of a depolymerization event. Graphs in Additional file 15: Figure S6 show the mean ± standard deviation, as well as individual measurements.