Lipophorin receptors regulate mushroom body development and complex behaviors in Drosophila

Rojo-Cortés, Francisca; Fuenzalida-Uribe, Nicolás; Tapia-Valladares, Victoria; Roa, Candy B.; Hidalgo, Sergio; González-Ramírez, María-Constanza; Oliva, Carlos; Campusano, Jorge M.; Marzolo, María-Paz

doi:10.1186/s12915-022-01393-1

Research article
Open access
Published: 07 September 2022

Lipophorin receptors regulate mushroom body development and complex behaviors in Drosophila

Francisca Rojo-Cortés^1,2,
Nicolás Fuenzalida-Uribe³,
Victoria Tapia-Valladares²,
Candy B. Roa^1,2,
Sergio Hidalgo^2,4,
María-Constanza González-Ramírez⁵,
Carlos Oliva⁵,
Jorge M. Campusano² &
…
María-Paz Marzolo ORCID: orcid.org/0000-0002-2328-2464¹

BMC Biology volume 20, Article number: 198 (2022) Cite this article

2645 Accesses
2 Citations
5 Altmetric
Metrics details

Abstract

Background

Drosophila melanogaster lipophorin receptors (LpRs), LpR1 and LpR2, are members of the LDLR family known to mediate lipid uptake in a range of organisms from Drosophila to humans. The vertebrate orthologs of LpRs, ApoER2 and VLDL-R, function as receptors of a glycoprotein involved in development of the central nervous system, Reelin, which is not present in flies. ApoER2 and VLDL-R are associated with the development and function of the hippocampus and cerebral cortex, important association areas in the mammalian brain, as well as with neurodevelopmental and neurodegenerative disorders linked to those regions. It is currently unknown whether LpRs play similar roles in the Drosophila brain.

Results

We report that LpR-deficient flies exhibit impaired olfactory memory and sleep patterns, which seem to reflect anatomical defects found in a critical brain association area, the mushroom bodies (MB). Moreover, cultured MB neurons respond to mammalian Reelin by increasing the complexity of their neurite arborization. This effect depends on LpRs and Dab, the Drosophila ortholog of the Reelin signaling adaptor protein Dab1. In vitro, two of the long isoforms of LpRs allow the internalization of Reelin, suggesting that Drosophila LpRs interact with human Reelin to induce downstream cellular events.

Conclusions

These findings demonstrate that LpRs contribute to MB development and function, supporting the existence of a LpR-dependent signaling in Drosophila, and advance our understanding of the molecular factors functioning in neural systems to generate complex behaviors in this model. Our results further emphasize the importance of Drosophila as a model to investigate the alterations in specific genes contributing to neural disorders.

Background

The low-density lipoprotein receptor (LDL-R) family is an ancient protein family conserved throughout evolution [1, 2]. In mammals, these proteins include two groups of membrane receptors, one of seven members including LDL-R, LRP-1, LRP-1B, LRP-2/megalin, LRP-8/ApoER2, VLDL-R, and MEGF7 and the second more distant group including SorLA/LR11 and the Wnt signaling receptors LRP-5 and LRP-6 [3]. The LDL-R family is widely known because of its role in lipoprotein endocytosis, controlling the systemic homeostasis of cholesterol by binding to apolipoprotein E (ApoE) and apolipoprotein B (ApoB) [4, 5] as well for their signaling properties [3, 6, 7]. Drosophila melanogaster express Arrow [8,9,10], the ortholog of LRP-5/6, Dmel/mgl the ortholog of mammalian LRP2/megalin involved in the control of melanization of the cuticle [11], and lipophorin receptors (LpRs) 1 and 2 [12,13,14]. LpR1 and LpR2 have been linked to lipid uptake in the context of oogenesis and neuronal activity, which is consistent with the known roles of several LDL-R family members in vertebrates [13, 15,16,17]. Lipophorins are the invertebrate’s molecular entity equivalent to lipoproteins in vertebrates and bind LpRs through their protein component (apolipophorin) [12]. In contrast to lipoproteins, which are destined to degradation in lysosomes, lipophorins are recycled with LpRs, after lipid unloading and uploading, similar to transferrin [1, 2].

Structurally, LpRs consist of seven to eight LA modules, three EGF modules, a β-propeller, an O-glycosylation site near the transmembrane domain, and a cytoplasmic tail [13]. Six isoforms for LpR1 and five for LpR2 have been described in Drosophila. These are generated by alternative use of two distinct promoters, proximal or distal [13]. The main consequence of the use of the proximal promoter is that the resulting transcript lacks exons 1 to 3, which encode for a non-conserved N-terminal region and the first LA module [13]. Thus, the isoforms transcribed from the proximal promoter are also known as the “short” ones, while those transcribed from the distal promoter are known as the “long” isoforms [13, 16, 18].

Only a subset of LpR isoforms mediate lipid uptake [13, 16,17,18]. Several reports link LpRs to functions beyond lipid metabolism. The first one showed that Drosophila LpR1 increases the immune response by modulating the uptake and degradation of Necrotic Serpin, a protein that controls the innate response to gram-negative infection in insects [14]. A second study showed that LpRs play a role in dendrite morphogenesis in larval ventral lateral neurons (LNv), a neuronal group that is part of the circuit that controls circadian rhythms in Drosophila [19]. Moreover, in the case of LpR1, this effect depends on the short isoforms. Specifically, it was reported that knocking down a specific LpR1 short isoform (LpR1G) or LpR2 in LNv reduces activity-dependent dendrite arborization [18, 19]. Since a genome-wide RNAi screen in cultured neurons from D. melanogaster embryos identified LpR2 as a gene implicated in neuronal development [20] and given the fact that LpR1 and LpR2 are widely expressed in the Drosophila larval brain [18, 19], it is possible to propose that LpRs could contribute to the development, maturation, and operation of several fly brain regions.

Drosophila LpR1 and LpR2 share with vertebrates LDL-R, VLDL-R, and ApoER2, motifs involved in intracellular trafficking and signaling, like the NPxY [2, 13]. In this regard, besides their role as lipoprotein receptors, VLDL-R and ApoER2 serve as receptors for the secreted glycoprotein Reelin, an extracellular ligand with essential roles in the central nervous system (CNS) [21,22,23,24]. Reelin functions include neuronal polarization and migration in critical association areas in the brain, such as the cerebral cortex, hippocampus, and cerebellum. In adult animals, Reelin is also implicated in synaptic plasticity, learning, and memory [22, 23, 25,26,27,28,29,30,31].

Here, we decided to advance on the characterization of the expression and function of LpRs in the fly brain. First, we showed that Drosophila mutants for LpR1 and LpR2 exhibit olfactory memory and sleep architecture deficits. Since these behaviors depend on a crucial associative region in the fly brain, the mushroom bodies (MB), we assessed whether LpR expression has any consequence on the structure of this fly brain area. Our data show relevant alterations in the MB organization of fly mutants for LpRs and also of animals where an RNAi for these receptors is directed to this brain region. Surprisingly, Drosophila MB neurons in primary culture were responsive to vertebrate Reelin by increasing their neurite tree’s complexity, as vertebrate neurons do. This effect depends on LpR1 and LpR2. Also, we show that cells bearing long isoforms of LpR1 and LpR2 internalize Reelin. In line with the idea of a Reelin-induced LpR-dependent response in flies, we described that MB organization and function, and the response of cultured MB neurons to Reelin, are affected by the absence of the cytoplasmic protein Dab, the fly homolog of Disabled 1 (Dab1) [32,33,34], which is the first component of the Reelin intracellular signaling cascade [35]. Overall, our results show, for the first time, that LpR1 and LpR2 contribute to Drosophila MB organization and function. Besides, our data suggest that both receptors would participate in a novel signaling cascade involving Dab, whose homolog, Dab1 in vertebrates, can be activated by Reelin.

Results

Fly mutants for lipophorin receptors exhibit impaired behaviors associated with MB function

In order to characterize the role of LpRs in the Drosophila brain, we first asked whether mutants for these receptors exhibit any alteration in one of the most studied behaviors in flies, aversive olfactory memory. We used a mutant for each LpR, generated by deleting a segment of the encoding genes [13]. These tools were validated through qPCR (Additional file 1: Fig. S1a-b). We carried out a protocol to generate mid-term aversive olfactory memories, as explained in the “Methods” section (Fig. 1a). Briefly, flies were exposed to two different odorants sequentially, but only the first odorant was paired to electric shocks. One hour after finishing the training protocol, the flies were allowed to choose between the two odorants. In control animals, the olfactory memory measured as performance index reached a magnitude of 0.44 ± 0.04, consistent with the idea that the training protocol generates new olfactory memories. Remarkably, the performance index recorded in the LpR1 and LpR2 mutants suggests that no memories were generated in these flies (0.00 ± 0.07 and 0.07 ± 0.14, respectively; p < 0.01 as compared to controls; Additional file 1: Fig. 1b). Additionally, as experimental controls, we evaluated the mutants’ ability to respond to the conditioning stimulus (electric shocks; Additional file 1: Fig S2a) and the odorants used (Additional file 1: Fig S2b-c). Interestingly, LpR1 mutants display a higher olfactory acuity toward one of the odorants used (Additional file 1: Fig S2b), which is one of the reasons we carried out the training protocol using either odorant as a conditioned stimulus for different experiments.

We then assessed circadian rhythms in LpR mutants while under a light–dark cycle of 12–12 h [36, 37]. Interestingly, the observation of actograms supports the idea that flies mutant for LpR1 and LpR2 exhibit increased sleeping time compared with control flies, particularly during the light phase (Fig. 1c, d). A summary of data collected over 6 days evidenced higher sleep time in both mutant strains during the light phase (Fig. 1d). Moreover, the expression of RNAi against LpR1 or LpR2 into MB neurons also increased the fraction of time sleeping during the light phase (Additional file 1: Fig. S3) compared to control animals. The RNAis were validated by qPCR using the pan-neuronal driver Elav (Additional file 1: Fig. S1c-d).

Altogether, these results support the idea that tampering with the expression of LpRs has functional consequences reflected by impairment in memory formation and the regulation of sleep patterns.

Lipophorin receptors contribute to adult mushroom body organization

The MB is a well-characterized Drosophila structure located in each side of the brain, linked to crucial associative fly behaviors, including olfactory learning and memory, sleep, and locomotion [38,39,40,41,42]. Therefore, we decided to study whether alterations in olfactory memory and sleep homeostasis in mutants for LpRs are associated with changes in MB anatomy.

The principal neurons in the MB, the Kenyon cells, organize their dendrites and axons to give rise to the Calyx, peduncles, and lobes (Fig. 2a) [43, 44]. The Calyx, localized in the posterior aspect of the fly brain, is a structure formed by the Kenyon cells soma and dendrites, while their axons project frontally, arranged in a bundle called the peduncle. Before the end, the axonal fibers turn perpendicularly to give rise to the so-called MB lobes. The lobes are classified in γ, α/β, and α’/β’, where β, β’, and γ lobes are positioned horizontally while α and α’ lobes are placed vertically [45]. This anatomical organization has functional roles in several behaviors [46,47,48], so we paid close attention to MB organization in our studies.

We evaluated fly brains from adult animals deficient in LpR1 or LpR2 expression. Our strategy comprised several different genetic tools for each gene: a deletion mutant for each LpR (described previously in the functional experiments), an insertion mutant for each LpR, and RNAi against the receptors’ transcripts specifically expressed in the MB using the Gal4-UAS system.

In the analysis of results obtained in mutants for LpR1 or LpR2, we found and classified a variety of phenotypes (Fig. 2c–g) as compared to control brains (Fig. 2b). These include mislocalized lobes (Fig. 2c) in which the positions of one or more lobes are altered; the classification includes guidance defects where the α or β axons are misguided along β or α axons, respectively, resulting in thicker lobes. In some cases, we observed that the distance between MB β lobes is reduced (Fig. 2d), while in other brains, we detected fascicles of axons from indistinguishable origin crossing the middle line, which results in partial or total β lobes fusion (Fig. 2e). Further, we detected brains in which a part of the structure of the MB was lost; for instance, the absence of the lobes (Fig. 2f), the presence of thinner or shorter lobes (Fig. 2g), and very rarely, the complete lack of the MB (data not shown). These phenotypes were classified, as shown in Fig. 2h,i and in the Additional file 2: Table S1.

In general, flies lacking one copy of the LpR1 gene (c309,eGFP/ + ; LpR1^DF/ +) showed a higher percentage (17%) of brains exhibiting any alteration in MB than flies lacking one copy of LpR2 (c309,eGFP/ + ;LpR2^DF/ +): (6.5%) (Fig. 2h). These differences are exacerbated in knockout animals for each of the LpRs (Fig. 2h). Thus, the knockout animals for LpR1 (c309,eGFP/ + ; LpR1^DF/LpR1^DF) display a 22.9% of brains with MB alterations, while in the knockouts for LpR2 (c309,eGFP/ + ; LpR2^DF/LpR2^DF) a 25.8% of the brains exhibit any anatomical alteration. The analysis of the distance between β lobes indicated that this defect is not present in mutants for LpR1 and LpR2 (Fig. 2i).

To corroborate these results, we evaluated the MB architecture in insertion mutant animals (Additional file 1: Fig. S4a, Additional file 2: Table S2) where we found similar results: 22.8% of the haploinsufficient animals for LpR1 (LpR1 CRIMIC/ +) show alterations in the MB structure, while in the homozygous mutant flies (LpR1 CRIMIC/LpR1 CRIMIC) this percentage increased to 53.3% (Additional file 1: Fig. S4a). Additionally, the distance between β lobes was reduced in the LpR1 mutant flies (Additional file 1: Fig. S4b). Regarding LpR2, the heterozygous mutant animals (LpR2 CRIMIC/ +) exhibit 18.9% of brains with MB alterations, while in the homozygous mutant flies (LpR2 CRIMIC/LpR2 CRIMIC) it is possible to record 26% of brains with MB alterations (Additional file 1: Fig. S4a).

We attempted two additional approaches to assess the importance of LpRs in MB phenotypes. First, we studied whether it was possible to rescue the MB phenotypes observed in LpR2 mutants, by doing a genomic rescue. For this, we generated LpR2 mutant flies that also contain a genomic segment where the wildtype LpR2 gene is included (LpR2 20 Kb,BAC/ + ;LpR2 CRIMIC/ + and c309,eGFP/LpR2 20 Kb,BAC;LpR2^DF/ +). The animals with the genomic rescue exhibited a normal MB architecture (Additional file 1: Fig. S4a).

To further address the importance of LpR1 and LpR2 specifically expressed in the MB, we evaluated potential defects in this structure in adult flies expressing RNAi under the control of the c309 driver (Additional file 1: Fig. 2j, k and Additional file 2: Table S3). Similar to data obtained with LpR mutants, the percentage of brains with MB alterations was higher in animal LpR1 knockdown (around 48%) as compared with LpR2 knockdowns (around 26%) (Additional file 1: Fig. 2j). On the other hand, the distance between MB β lobes was found significantly diminished only in animals expressing the RNAi for LpR1 (Fig. 2k).

To confirm that these defects were triggered by the reduced expression of LpRs and not by an artifact of the MB driver used (c309-Gal4), we expressed the RNAi for the LpRs under the control of a second driver: OK107-Gal4 [49] (Additional file 1: Fig. S4 and Additional file 2: Table S4). This driver is strongly expressed in the whole MB but also exhibits significant expression in some neurons that do not belong to the MB [43]. The structure of MB was similarly affected in animals expressing RNAi for LpR1 or LpR2 (phenotypes were observed in 50% and 41.4% of the brains analyzed, respectively) (Additional file 1: Fig. S4d). It was evident that the OK107 driver was associated with more severe phenotypes, including the disappearance of entire lobes. Similar to what was found using the c309 driver, the distance between β lobes was reduced in the MB after LpR1 knockdown (Additional file 1: Fig. S4d).

Overall, these results suggest that LpR1 and LpR2 play a relevant role in the proper development and establishment of the adult MB structure.

Lipophorin receptor expression in mushroom body at distinct developmental stages

Our results support the idea that LpRs contribute to the establishment of the typical anatomical organization of adult Drosophila MB so that flies deficient in these receptors exhibit alterations in this brain structure. To advance on this idea, we decided to study the expression of LpR1 and LpR2 in MB at distinct developmental stages in Drosophila. For performing this task, we used some of the tools described above.

By using the Gal4-UAS system to command the expression of fluorescent proteins under the control of an LpR1 driver, we found that in the adult brain LpR1 was highly enriched in a group of neurons found adjacent to the MB β/β’ lobes and in the central complex (Fig. 3a, inset, arrowheads), while its expression in the rest of the brain was rather diffuse. The cells showing the highest LpR1 expression in the fly brain seem to be the neurons projecting to the ring of the ellipsoid body [50,51,52]. As an alternative approach, we used a LpR1 antibody previously reported [13] and FasII staining to identify the MB (Additional file 1: Fig S5). Both strategies provided similar results. We also assessed the expression of LpR2 in the adult fly brain, employing a protein trap line generated by Recombination-Mediated Cassette Exchange (RMCE). In this line, the RMCE cassette is placed between the exons 12 and 13 of LpR2 and contains a GFP coding-exon that tags all the LpR2 isoforms [53]. Our data showed that LpR2 was not enriched in any specific brain region (Fig. 3b). These results suggest that both LpR1 and LpR2 exhibit a rather diffuse expression throughout the adult fly brain, although LpR1 is highly expressed in a group of cells surrounding the MB.

Considering the evidence obtained in adult flies, we analyzed the expression of LpRs in MB over larval and pupal stages, posing the idea that the alterations in adult MB structure could be explained by a modification in the developmental program that gives rise to this fly brain region. The MB begins to develop in the embryonic stage, starting from four neuroblasts per hemisphere that divide until the late pupa stage. The γ lobe develops until the mid-third instar larval stage. The α’ and β’ lobes are generated by the end of the third larval stage, while the development of α and β lobes reach maturity at the pupal stage [54, 55].

Using the LpR1 Gal4 tool, we assessed the expression of LpR1 in the larval and pupal stages. At the larval stage, LpR1 was found at low levels in the horizontal γ lobe, with a widespread expression in the midline area of the brain and the photoreceptors, while in pupae, the receptor was found highly expressed in the central complex and in a group of neurons that surround the horizontal lobes (Fig. 3a, arrowheads), similarly to what was found in adult flies. On the other hand, the RMCE tool was used to assess the expression of LpR2 in the larval and pupal stages. In larvae, LpR2 was observed in cells located in the midline area and the photoreceptors, whereas in pupae, it was observed in cells in the brain cortex (Fig. 3b). These results indicate that LpR1 and LpR2 expression is widely distributed in the fly brain cells throughout development, and suggest that they play a relevant role in the proper development and establishment of the adult brain MB structure.

LpRs contribute to Drosophila MB neurite development

The proposed orthologs for LpR1 and LpR2 in vertebrates are ApoER2 and VLDL-R [2, 6]. These membrane proteins are the primary receptors for Reelin in CNS [23, 29, 56] and participate in the development and function of the cerebral cortex and hippocampus, among other brain areas. Besides LpRs, Drosophila has orthologs for other proteins involved in Reelin signaling, including the adaptor protein Dab (see below). Thus, we proposed that Drosophila neurons in culture would respond to mammalian Reelin, increasing their neurite complexity, as reported in cultured rodent neurons [57,58,59,60]. Strikingly, we found that our prediction was correct: MB neurons significantly increased their neurite branching in response to mammalian Reelin compared to effects induced by mock media (Fig. 4). Moreover, the response changed depending on the concentration of Reelin used (Fig. 4a, b); the maximum effect was observed at a concentration of 30 nM similar to that previously used in mammalian hippocampal and cortical neurons [60, 61]. Several parameters highlighting the complexity of the neurite arborization were studied. For instance, Reelin treatment increased the maximum length that neurites can reach compared with mock-treated neurons (Fig. 4c). Besides, Reelin exposure also increased the distance (from the soma) in which the maximum number of neurites is observed (critical value) (Fig. 4d).

Next, we determined the role of LpRs in the morphological effects induced by Reelin in primary culture neurons. First, we verified the expression of LpRs in Drosophila brain cultured neurons (Additional file 1: Fig. S6). Then, LpR1- or LpR2-deficient flies were used to prepare neuronal cultures that were exposed to 30 nM of Reelin. Our results showed that the LpR-deficient MB neurons did not respond to Reelin, while responses to this signaling molecule were evident in cultured MB neurons from control animals (Fig. 5). Interestingly, under basal conditions, LpR1 mutant neurons already showed impaired neurite development (Fig. 5a). Other defects were also evidenced when studying the maximum length of neurites (Fig. 5b) and the critical value (Fig. 5c). Similarly, neuronal cultures derived from LpR2 mutant animals did not respond to Reelin, although a basal alteration in neurite development was not observed (Fig. 5d–f).

To confirm these results and dissect the contribution of LpRs specifically in MB neurons, we took advantage of flies expressing RNAi for LpR1 or LpR2 only in the MB by using the Gal4-UAS system. By performing the same type of experiments outlined above, we obtained similar results to those described in cultured neurons from mutant flies: the inability of MB neurons to respond to Reelin when expressing RNAi for LpRs (Fig. 5g–l). Overall, these results show for the first time that vertebrate Reelin stimulates the growth and neurite complexity of Drosophila MB neurons in a way that depends on the expression of LpRs.

LpRs long isoforms are required to mediate Reelin internalization

The interaction of Reelin with ApoER2 and VLDL-R requires the LA modules in the extracellular domain of the receptors [21, 24], which are conserved in LpRs [2, 13]. Since the main difference between the different isoforms for LpRs is the presence of the first LA module plus the non-conserved domain, we asked whether the effect observed in neuronal cultures exposed to vertebrate Reelin depends on specific isoforms of LpRs. In order to work on this question, we used the insect cellular model S2, which does not express LpRs [16].

To test a functional Reelin-LpR interaction, we carried out a ligand internalization assay in which S2 cells were transiently transfected with the following available tools: two long isoforms of LpRs tagged with an HA epitope (i.e., LpR1J-HA or LpR2E-HA) and one short isoform of LpR2: LpR2F-HA (Fig. 6a, Additional file 1: Fig. S7). Reelin was internalized only in cells expressing the longer forms of the receptors, either LpR1J-HA or LpR2E-HA (Fig. 6a). Meanwhile, S2 cells transfected with the LpR2F isoform (Fig. 6a) or the empty plasmid (Additional file 1: Fig. S8a) did not internalize Reelin.

The Receptor-Associated Protein (RAP) is a chaperone required for folding the LDL-R family members. RAP binds with high affinity to the ligand-binding domains of the receptors, preventing their premature interaction with ligands within the endoplasmic reticulum [62]. Several antecedents show that the extracellular addition of recombinant RAP prevents the binding of LDL-R family members to their respective ligands, including the binding of VLDL-R and ApoER2 with Reelin [35, 62,63,64]. In addition, Van Hoof et al. [65] showed that the internalization of Locusta migratoria Lipophorin by its LpR is completely inhibited by adding the recombinant form of the human RAP. Then, to evaluate whether Reelin internalization depends on a classical interaction with lipoprotein receptors, the internalization experiment was performed in the presence of RAP (Fig. 6b, Additional file 1: Fig. S8b). Reelin entrance to the cells, mediated by LpR1J or LpR2E, was prevented by the presence of RAP in the media (Fig. 6b).

Overall, these data suggest an interaction between mammalian Reelin and the two longer LpRs isoforms, which could underlie a novel, previously not described, signaling cascade.

Dab is required for Reelin-induced responses in MB neurons

Reelin signaling requires the dimerization of ApoER2 or VLDL-R and the concomitant recruitment of the cytosolic adaptor protein Dab1 to the NPxY motif present in the cytoplasmic tail of these receptors [30, 35, 66]. In Drosophila, Disabled (Dab) is the homologous form of vertebrate Dab1 [33, 67]. To determine whether Dab contributes to the Reelin-induced response in MB neurons in culture, we used a mutant fly lacking one copy of Dab [68]. In our hands, homozygous mutants for this gene die before reaching the third instar larvae. The reduction of Dab expression in this mutant was corroborated by qPCR (Additional file 1: Fig. S9a). We carried out the same type of in vitro experiments described when assessing the role of LpRs in primary neurons, but now in cultures prepared from Dab heterozygous mutants (Fig. 7a–c). The Dab mutant neurons failed to respond to Reelin treatment: there was no change in neuronal arborization (Fig. 7a), maximum length (Fig. 7b), or the critical value (Fig. 7c). As a complementary approach to corroborate these findings, Reelin was added to cultures prepared from brains expressing RNAi for Dab specifically in the MB, using c309-Gal4 (Fig. 7d–f). The diminished expression of Dab was verified through qPCR (Additional file 1: Fig. S9b). As with the Dab mutant cultures, Reelin treatment did not increase the complexity of neurite branching (Fig. 7d), the maximum length (Fig. 7e), or the critical value (Fig. 7f) in MB neurons expressing RNAi for Dab. These results show that Dab plays a relevant role in the response of MB neurons to Reelin.

Dab is required for MB development and function

To determine whether mutant flies for Dab exhibit alterations in olfactory memory, we carried out the training protocol as outlined for LpR mutants. The performance index of flies lacking one copy of Dab was significantly lower than that of control animals (Fig. 8a). These flies exhibited a normal response to the electric shocks and the odorants used (Additional file 1: Fig. S10 a-c). Additionally, we evaluated sleep patterns in animals deficient in Dab expression (Fig. 8b, c). Mutant flies exhibited higher sleep time throughout the day, regardless of the phase (Fig. 8b, c). The sleep patterns were also assessed in flies expressing an RNAi against Dab in the MB (Additional file 1: Fig. S11). Interestingly, flies knockdown for Dab in the MB exhibit a normal sleep pattern (Additional file 1: Fig. S11). Overall, these data suggest that Dab contributes to sleep homeostasis, but not by an action in the MB.

We also studied the contribution of Dab to MB organization by using two different genetic tools: mutants generated by a deletion in the Dab gene or animals expressing, only in MB neurons, an RNAi directed to transcripts of this gene (Fig. 9, Additional file 2: Table S5-S7). The phenotypes observed in the Dab-deficient animals included mislocalized lobes in 11.7% of brains (Fig. 9a, b). Besides, Dab mutants exhibit a lower distance between β lobes (Fig. 9c). On the other hand, 41.2% of the brains from flies expressing RNAi against Dab exhibit MB with β lobes fused or axons crossing from one β lobe to the opposite (Fig. 9a, d, e). Therefore, compared to controls, MB from Dab-deficient flies exhibit their β lobes closer.

Finally, to evaluate the possibility of a genetic interaction between Dab and LpRs, we assessed the MB architecture in animals deficient in one allele in Dab while in the other allele where deficient for LpR1 (Fig. 9f, Additional file 2: Table S7). In these new experiments, we recorded 5% of the brains with MB alterations in Dab haploinsufficient animals (Dab¹/ +) (Fig. 9f). On the other hand, 22.8% of the LpR1 heterozygous mutants (LpR1 CRIMIC/ +) displayed anatomical phenotypes (Fig. 9f). Remarkably, flies bearing one copy of the mutant alleles for each gene (LpR1 CRIMIC / Dab¹) exhibited 53% of the brains with alterations in the MB structure (Fig. 9f). In all of the brains, we observed merging of the MB lobes, and consistently, these flies presented β lobes very close to each other (Fig. 9g). These data are in support of the idea of a genetic interaction.

These results show that the presence of Dab is necessary for MB development and function in a similar way to LpRs.

Discussion

Here we have demonstrated that LpR1, LpR2, and the adaptor protein Dab have a relevant and previously unnoticed role in the correct anatomical organization of adult MB and consequently in its associated functions, including olfactory memory performance and sleep patterns. Besides, the exposure of cultured Drosophila MB neurons to mammalian Reelin, a protein not present in flies, resulted in augmented neurite growth and complexity, an effect that depends on these receptors and Dab. Further, two of the LpRs long isoforms, LpR1J and LpR2E, are required for the internalization of Reelin in S2 cells.

LpRs are required for adult MB structure and operation

The expression of LpR1 or LpR2 or the intracellular adapter Dab in MB is crucial for proper performance in memory assays. Despite we found a difference in the naive olfactory response recorded in LpR1 mutants as compared to control animals that constitute a confounding effect on olfactory memory results, the entire set of results support that there is an effect on olfactory memory, which is not surprising given the strong anatomical phenotypes observed in LpR1 mutants. Further experiments are required to evaluate whether LpRs expressed in specific MB subpopulations differentially contribute to olfactory memory. The MB, fly brain region linked to the generation and storage of olfactory memories [44, 69], is proposed to play a homologous function to the mammalian hippocampus [70,71,72,73]. The MB and the hippocampus categorize stimuli according to the type of signal received and the context in which the signals are received, fundamental aspects for learning and memory processes [71]. Moreover, numerous ortholog genes are required in the hippocampus and MB for similar functions [73].

On the other hand, LpRs also participate in normal sleep homeostasis, another function associated with MB [40, 41]. Whether LpRs are required in brain regions beyond MB for sleep homeostasis is an issue we did not explore in this work. Interestingly, Yin et al. [19] showed that the reshuffle of LNv dendrites under light stimuli was prevented when LpRs expression was eliminated [19]. Dab mutants also exhibited a higher sleep time throughout the day. Given the fact that sleep phenotypes were observed only with the mutants but not confirmed in animals expressing RNAi against Dab in MB, future studies should extend our analysis on how Dab influences sleep phenotypes. Further steps in assessing these issues could be also directed to evaluate how LpRs and Dab expressed in circadian regions contribute to sleep homeostasis.

The defects in MB structure observed in mutants for LpR1, LpR2, and Dab indicate the importance of these proteins in the appropriate organization of this fly brain region along development, determining its function in adult animals. Although we did not observe a high expression of LpR1 in the adult MB, our data show that it is enriched in the horizontal lobe in the third instar larvae, a stage where the MB cells are developing [48]. Our expression studies demonstrating diffuse expression of LpR1 and LpR2 in third instar larvae are coincident with previous reports [18, 19]. Interestingly, our results using the LpR1-Gal4 tool in adulthood and pupae stage showed that the receptor’s highest expression is not in the MB itself but in a group of cells surrounding the β’/β lobe of this structure. The complementary use of the LpR1 antibody supports the notion that these cells could be R neurons from the ellipsoid body [50,51,52]. Future experiments using ellipsoid body Gal4-specific drivers would be needed to demonstrate this idea. In addition, these data would suggest that MB extrinsic neurons, which exhibit the highest expression for LpR1 in fly brain, are somehow signaling to the MB neurons during development to generate the typical organization of adult MB. This proposal would also need evaluation. Remarkably, similar mechanism has been demonstrated for other proteins. For instance, Ptpmeg is a cytoplasmic tyrosine phosphatase highly expressed in the ellipsoid body and little expressed in adult MB. The reduction of Ptpmeg expression results in MB phenotypes, similar to those described here [74]. A similar situation occurs with the long-chain acyl-CoA synthetase 4 (ACSL4), a protein expressed at low levels in the MB but required for its adequate development [75]. Axonal patterning defects could underlie some of the phenotypes observed in animals deficient for LpRs [76]. Future studies on how MB structure is formed over development in LpR- and Dab-deficient animals could support these ideas.

Axonal patterning defects could underlie some phenotypes observed in animals deficient for LpRs [76]. For example, the fusion of the β lobes is an indication of excessive and uncontrolled growth of axons crossing toward the contralateral hemisphere. It could be speculated that axons bearing LpRs and Dab should sense a stop signal close to the midline. When some intrinsic or extrinsic components are not present, the β axons cross the midline. In this regard, it is worth highlighting a parallel with the role of ApoER2, VLDL-R, Dab1, and Reelin in the process of cell migration and axonal growth and targeting [77]. Reelin functions as an attractive cue for neuronal migration in the hippocampus and the cortex [23, 26, 78], as well as for axonal targeting in the visual system [79, 80] and the entorhinal-hippocampus circuit [81, 82]. Besides, Reelin behaves as a stop signal in the vicinity of cells secreting it (i.e., Cajal-Retzius in the developmental cortex and hippocampus). Therefore, in the absence of the receptors, Dab1 or Reelin, neurons invade the marginal zone [30, 67]. In the case of Reelin, the stop signal relies on the activation of Rho GTPases and LIMK [29, 83]. In Drosophila, the growth of MB axons of the α/β lobes is also controlled by attractive and repulsive cues, and in some cases, as for the TGF-β 1 receptor, the stop signal includes LIMK activation [84].

Other phenotypes observed upon LpRs knockdown are stalling of MB lobes. Previous studies show that overexpression of LIMK and some manipulation of Rho GTPases activity lead to MB axon stalling [85, 86], which is consistent with the role of Reelin in the control of these cytoskeleton regulators. Finally, defects in guidance in which the α and β lobes follow the same trajectory have been observed in mutants of the Eph-Ephrin [87] and Wnt5/Drl1/2 [88] signaling pathways, indicating LpR could be part of a complex signaling network regulating MB axon guidance.

Consistent with the structural and functional studies in the Drosophila brain, the experiments carried out in primary cultured neurons support the importance of LpRs in the structure of MB cells. Our data show impairment in basal neurite development in cultured neurons from mutants for these genes. The primary neuronal culture is a cell system generated from pupal brains, and therefore, phenotypes observed argue in favor of the idea that LpRs play a role in MB development.

Although the correlation between alterations in MB structure and behavioral phenotypes has been previously reported for several mutants of Drosophila genes [47, 89], to our understanding, this is the first time that this is shown for mutants in LpRs or the adaptor Dab. Overall, our results suggest that LpR and Dab regulate several aspects of MB morphogenesis and function, and future studies should address its interaction with other pathways involved in these processes.

Hints on a novel function for LpRs

Regarding the function of LpRs in Drosophila, both receptors have been primarily associated with lipid uptake [12, 13, 16, 17]. Thus, disturbing LpR1 or LpR2 expression in early developmental stages reduces neutral lipid content in oocytes and imaginal discs. This phenotype is rescued by expressing long isoforms of LpRs, LpR1H, and LpR2E [13]. ApoD and ApoE are endocytosed in mammalian cells by ApoER2 and VLDL-R [1, 90]. Recent work from Yin et al. [18] shows that a short isoform of LpR1 (LpR1G) interacts with the lipocalin Glaz. Interestingly, a report from the Bellen group shows that the transport of lipids between neurons and glia is mediated by Glaz and neural lazarillo proteins (Nlaz), the orthologs for ApoD in flies [91]. The mechanism associated with lipid uptake by the glia is unknown. It is then possible to hypothesize that some of the alterations we described in MB in LpRs-deficient animals could be due to deficits in the transport of lipids between neurons and glia.

Interestingly, Matsuo et al. [16] showed that the lack of LpR1 and LpR2 does not significantly affect triglycerides levels in the CNS of third instar larvae, while the brain content of only few phospholipids seem to be affected in these deficient animals. This phenotype was also described by Yin et al. [18]. Since the highest expression for LpRs is described at the larval stage, the work of Matsuo et al. has several implications. First of all, it indicates that there are probably other complementary mechanisms responsible for the uptake of neutral lipids, so that deficiency on LpRs is not associated with a dramatic decrease in larval lipid content. Also, it supports the idea that LpRs could play other roles in addition to lipid uptake. In this regard, it was shown that LpR1 and LpR2 are required for proper LNv dendrite development and that these receptors are necessary for LNv structural plasticity in response to light stimuli in third instar larvae [19]. The mechanisms by which the light-induced increase in synaptic activity is related to LpR function were not discussed [19].

Strikingly, our data show that cultured MB neurons respond to Reelin treatment in a way depending on the expression of LpRs and Dab. The Reelin-induced increase in neurite arborization is similar to what has been previously described in cultured hippocampal neurons [57,58,59,60]. Likewise, the absence of a Reelin-induced response in cultured fly neurons deficient in LpRs is similar to the situation observed in cultured vertebrate neurons when the function of ApoER2 and VLDL-R is inhibited [59, 61].

Our results also show that the long isoforms of LpR1 and LpR2, LpR1J and LpR2E, respectively, bind and internalize mammalian Reelin in Drosophila cells. Since we only evaluated some of the LpR isoforms, we cannot discard that other LpRs would mediate Reelin interaction and internalization or that other long isoforms participate in MB development. Nevertheless, our results suggest that LpRs short isoforms would have a different role than the two long isoforms.

The prevention of Reelin internalization by RAP indicates that Reelin would bind LpR1J and LpR2E isoforms through its cysteine-rich repeats in the LA module, like the rest of the LDL-R family members [6, 55, 83]. Reelin signaling also requires the interaction of Dab1 through its PTB domain with the NPxY motif of ApoER2 and VLDL-R [33, 35, 92]. As mentioned, the same motif is found in LpR1 and LpR2 [13], while the PTB domain is conserved in Dab from Drosophila melanogaster [33]. Furthermore, once Dab1 binds to ApoER2 or VLDL-R, it is phosphorylated in two groups of tyrosine residues [66], and it is already known that Drosophila Dab tyrosines can be phosphorylated [93]. The phosphorylation of Dab1 is crucial for the activation of downstream signaling molecules, including PI3K and Crk/CrkL, which results in the modification of cytoskeleton dynamics and membrane trafficking [1, 27, 29, 57, 58, 94,95,96,97]. Thus, it would be interesting to evaluate, in the future, whether Reelin binding to LpRs triggers a signaling pathway that depends on the phosphorylation of Dab.

As previously mentioned, Reelin is not present in flies. However, a study suggests that protein domains found in vertebrate Reelin appeared in evolution with the filum Arthropoda, to which Drosophila belongs [98], supporting that a Reelin-like protein could exist in at least some invertebrates. We are currently analyzing the Drosophila melanogaster genome to unveil whether flies have a protein with a homolog function to vertebrate Reelin.

Conclusions

We have established new physiological and developmental roles for LpR1, LpR2, and Dab in Drosophila MB by using heterozygous mutants and RNAi targeted expression. Overall, all these results are consistent with the idea that we have uncovered a novel signaling pathway relevant to MB formation and function. Besides, our data provide support for the existence of a Reelin-like protein in Drosophila.

Methods

Drosophila stocks

Flies strains and F1 progeny when needed were raised under 12 h:12 h light:dark cycle at 25 °C. The flies were fed with standard fly food. The flies employed were generated using flies from Bloomington Drosophila Stock Center (BDSC). Whenever needed, flies were isogenized to w¹¹¹⁸ genetic background for at least five generations. Flies used were as follows: y¹w*; Mi{PT-GFSTF.1}^{LpR2MI04745GFSTF.1}(RRID:BDSC_60219), LpR1-Gal4: w¹¹¹⁸; PBac{w^+mC = IT.GAL4}LpR1^0104−G4/TM6B,Tb¹ (RRID:BDSC_62639), LpR1^DF: w*;P{w^+mC = XP-U}LpR1^Df/TM6B,Tb¹ (balancer chromosome changed from RRID:BDSC_32653), RNAi LpR1: w*; P{y^+t7.7 v^+t1.8 = TRiP.JF02551}attP2 LpR1 (isogenized from RRID:BDSC_27249), LpR2^DF: w¹¹¹⁸;rho^ve−1 PBac{w^+mC = RB3.WH3}LpR2^Df/TM6B,Tb¹ (balancer chromosome changed from RRID:BDSC_44233), RNAi LpR2: w*; P{y^+t7.7 v^+t1.8 = TRiP.JF01627}attP2 LpR2 (isogenized from RRID:BDSC_31150), Dab¹: w¹¹¹⁸;Dab¹/TM6B, Tb¹ (balancer chromosome changed from RRID:BDSC_32653) and RNAi-Dab: w*;P{y^+t7.7 v^+t1.8 = TRiP.HMS02482}attP2 Dab (isogenized from RRID:BDSC_42646). In addition we used the flies: c309-Gal4, UAS-eGFP (c309,eGFP), Elav-Gal4, UAS-CD8::GFP;;OK107-Gal4, c309-Gal4; UAS-CD4::tdTomato. Further, flies generated in this work include the following: the CRIMIC insertion mutant for LpR1: yw;; LpR1 CRIMIC/TM3,Cy, the CRIMIC insertion mutant for LpR2: yw;; LpR2 CRIMIC/TM3, Ser, the genomic rescue for LpR2 (LpR2 20 Kb, BAC/SMA6a,Cy): yw; PBac{CH321-09A20}VK37/SM6a,Cy.

Measurement of mRNA levels

To demonstrate the reduction in the expression of mRNA levels in strains of interest, 50 adult male heads (0–3 days) were homogenized in TRIzol (Invitrogen). Chloroform (Merck) was added, mixed, and then centrifuged at 12,000 rpm (4 °C) for 15 min. The aqueous phase was collected and then mixed with isopropanol (Merck), followed by incubation, and posterior centrifugation at 12,000 rpm (4 °C) for 20 min. The pellet was air-dried and then resuspended in nuclease-free water at 55 °C for 15 min. RNA integrity was evaluated by running an aliquot of this preparation in an agarose gel, and RNA concentration was determined in an Epoch microplate reader (Biotek). The cDNA synthesis was carried out from 3 µg of RNA using the kit RevertAid First Strand cDNA Synthesis (Invitrogen).

The primers were directed to two exons that are present in all isoforms of the genes: LpR1: 5′–TGCACGAATGGAGCCTGCAT–3′ and 5′–GTGATGCGATCCTTGCACTGGT–3′, annealing at 60 °C; LpR2: 5′–CTATGTCGTATACCGACGCTGC–3′ and 5′–CTGCGGCGTAAATGTGTGG–3′ annealing at 57 °C; Dab: 5′–GTCTTAGCACCACGAATGGAA–3′ and 5′–GGCGTTATCCGTTCCATCT–3′ annealing at 55 °C. GAPDH was used as a reference gene: 5′–CGTTCATGCCACCACCGCTA–3′ and 5′–CCACGTCCATCACGCCACAA–3′ annealing at 60 °C. The reaction used the 5 × HOTFIREPol® EvaGreen® qPCR Mix Plus Kit (Solis BioDyne), and LightCycler® capillaries (20 μL), in the LightCycler® (Roche) apparatus. Primer efficiency was evaluated after serial dilution and was calculated as 10^−1/slope. The relative expression was calculated as [primer efficiency for GAPDH^{CT average among replica}]/ [primer efficiency for the gene of interest^{CT average among replica}].

Each MB is composed of about ~ 2500 neurons [43] out of the about 100,000 found in fly brains. To test the RNAi effectiveness by qPCR, the RNAi of interest was pan-neurally driven by Elav-Gal4 (Additional file 1: Fig. S1c and d, Fig. S8b). This is a gal4 driver for the whole nervous system, and it is not expressed in other cell types in the fly head. Then the expression measured corresponds to an estimation of the mRNA levels.

Aversive olfactory conditioning

Groups of 40–50 flies were collected and kept at 25 °C and 70% relative humidity under 12 h:12 h light/dark cycles in the behavioral room. Experiments were conducted using a T-maze apparatus connected to a constant airflow (3 l/min) to provide flies with either fresh air or a given odorant. The process consists of airflow passing through bubbling mineral oil or a solution of the odorant dissolved in mineral oil. The experiments were conducted under dim red light to prevent confounding visual effects on olfactory memory formation [99, 100].

On the day of the experiment, flies were transferred into a training tube lined with an electrified grid. After 90-s acclimatization to the tube, flies were exposed to an odorant (the conditioned stimulus, CS⁺), either 3-octanol (OCT) or 4-methyl cyclohexanol (MCH), paired to twelve 70 V DC electric shocks (the unconditioned stimulus, US) over 60 s (Fig. 3). This procedure was followed by a 45-s rest period with fresh air. Flies were then exposed to the reciprocal odorant (CS⁻), which is not paired to electric shock. Memory was evaluated 1 h post-training to test Mid-term memory (MTM). For this, flies are exposed to both odorants, each in one tube; the number of flies choosing each tube was quantified. A performance index (PI) was calculated as:

$$PI= \frac{({CS}^{-}-{CS}^{+})}{({CS}^{-}+{CS}^{+})}$$

The odorant used as CS⁺ was alternated between OCT and MCH in experiments carried out with different groups of flies, to account for innate bias toward one odorant. Thus, n = 1 corresponds to the average of the PI of two consecutive alternated groups. Sensory-motor controls were performed to assess whether avoidance of electric shocks or odorants were similar between different strains. For olfactory acuity, the odorant and air were pumped through opposite arms of the T-maze; flies were allowed to choose between the two tubes for 2 min. For electric shock avoidance, flies were allowed to decide between two training tubes, one of them connected to the stimulator providing electric shock. For olfactory and shock processing, the fly avoidance over the stimuli was quantified, and responses were reported as the percentage of flies that avoided the stimuli over the total number of flies (Additional file 1: Fig. S2).

Locomotor and sleep analysis

Locomotor activity was measured using the Drosophila Activity Monitoring System (DAM, TriKinetics Inc, USA), using 7–9-day-old male flies. The individuals were collected, separated by phenotype, and transferred into DAM tubes containing standard fly food and placed into an incubator (25 °C and 75% humidity) connected to the monitoring system (TriKinetics, Waltham, MA, USA) under 12 h:12 h light–dark cycles for 6–7 days. After 6 days of baseline recordings, the sleep analysis was performed in R using the Rethomics framework [101]. Sleep is defined as a continuous period of inactivity lasting 5 min or more [36, 37], and activity counts to actogram profiles (Additional file 1: Fig. S2e, Fig. S3 c and f, Fig. S10d and Fig. S11c) were calculated as the number of beam crossings each 30 min.

Fly brain immunohistochemistry

Brains from (i) c309,eGFP/ + ;LpR1^DF/ + ; (ii) c309,eGFP/ + ;RNAi-LpR1/ + ; (iii) c309,eGFP/ + ;LpR2^DF / + ; and (iv) c309,eGFP/ + ;RNAi-LpR2/ + 0–3-day-old adult male flies were fixed for 20 min with 4% PFA, 4% Sucrose in PBS1X. The tissue was blocked (solution: 3% Normal Goat Serum (NGS), 0.03% Sodium Azide in Phosphate-buffered saline with 0.3% Triton-X100 (PBS-T) for 1 h, and then incubated with 1D4-FasII antibody (RRID: AB_528235) 1:20 at 4 °C, overnight (ON). After 3 h of incubation with secondary antibody Alexa Fluor 568 goat anti-mouse (RRID: AB_144696) 1:500, at room temperature (RT), brains were mounted with ProLong Gold with DAPI (Invitrogen).

Cell culture immunocytochemistry

Primary cultured neurons were fixed with 4% paraformaldehyde (PFA) and 4% sucrose in PBS1X for 20 min. Then, cell cultures were incubated for 15 min with 0.15 M Glycine and washed three times with PBS-T. The cells were blocked (solution: 3% NGS, 0.03% Azide in PBS-T) for 1 h, followed by overnight (ON) incubation at 4° with the primary antibodies: Guinea Pig anti LpR1 (Gifted by J. Culi) 1:100 or GFP antibody (RRID: AB 94,936) 1:500. Then, the coverslips were washed three times with PBST and incubated for 2 h at RT with secondary antibodies. Secondary antibodies used were goat anti-guinea pig 648 (RRID: AB_2340476) 1:350 or Alexa Goat anti-mouse 488 (RRID: AB_2633275). Later, the cells were washed three times with PBS-T. The coverslips were mounted in Fluoromount-G with DAPI.

Preparation of primary cultures of pupal brain neurons

As previously reported [102, 103], in brief, fly brains were dissected out of the animals at pupal stage P9, in dissecting solution (DS), consisting of 6.85 mM NaCl, 0.27 mM KCl, 0.009 mM Na2HPO4, 0.001 mM KH2PO4, 0.2772 mM HEPES, pH 7.4. After enzymatic treatment of the tissue (9.6 U/ml of papain, Worthington, LS 03,126) 30 min, at room temperature, mechanical disaggregation was carried out in culture plates containing Laminin-Concanavalin A (Sigma)-coated coverslips in the presence of DMEM/F12 culture medium (Gibco, 12,400–016) supplemented with 100 μg/ml Apo-Transferrin, 30 nM selenium, 50 μg/ml insulin, 2.1 mM 20-hydroxyecdysone, 20 ng/ml progesterone, 100 μM putrescine (all supplements from Sigma-Aldrich), and 1% antibiotic/antimycotic (Gibco 15,240,062). The following day, the cells received conditioned media obtained from astrocytes cultured in Neurobasal medium supplemented with B27 (CNBM/27).

Reelin production

Reelin was obtained as conditioned media from a cell line (HEK293T) that stably expresses mammalian Reelin [104]. Cells were cultured in DMEM high glucose (Gibco) supplemented with fetal bovine serum (10% FBS, Biological Industries), 1% penicillin/streptomycin (Gibco), and G418 (0.5 mg/ml). In order to collect Reelin, the culture media is serum-free. The supernatant containing Reelin was collected for 5 days, and the medium was concentrated using Amicon ultra-15 100-kDa filters (Millipore). Reelin concentration in the medium was estimated semiquantitatively: BSA dilution curves and an aliquot of Reelin-containing medium were run through an SDS-PAGE. The gel was stained with Coomassie blue to visualize reelin bands. After that, the bands corresponding to BSA and Reelin were digitalized to analyze intensities in Fiji [105].

Reelin treatments for Sholl analysis

Primary neuronal cultures were prepared on 12-mm coverslips and maintained in 24-well plates. Five days in vitro (DIV) cultures were treated with Reelin at 13 or 30 nM for 48 h. In parallel, neurons were treated with culture media collected from Hek293 cells transfected with the empty vector (Mock medium). Afterward, cultures are fixed and mounted, as mentioned above.

Internalization assay

S2 cells were transfected with plasmids pAC5.1-LpR1J-HA, pAC5.1-LpR2E-HA, pAC5.1-LpR2F-HA, or the empty vector using the calcium phosphate method. After 48 h of expression, the cells were treated with 30 nM Reelin or the equivalent volume of Mock media for 30 min at 27 °C. Then, the cells were washed one time with Schneider medium, twice with the same medium but at pH = 3.2, and two more times with Schneider medium. The cells were fixed, and immunocytochemistry was performed as mentioned above. The primary antibodies used were HA antibody (RRID: AB_1549585) 1:500 and E4 Reelin antibody (RRID: AB_1157891) 3:17. The secondary antibodies were Alexa Fluor 488 Chicken anti Rabbit (RRID: AB_2535859) 1:500 and Alexa Fluor 568 goat anti-mouse (RRID: AB_144696) 1:500.

Analyses

MB morphology was evaluated in both hemispheres in Fiji. It also measured the distance between the MB lobes in Fiji [105].

Statistical analyses were performed using GraphPad Prism, except for the Fisher test, which was performed using R and “fisher. test” from package “stats” version 4.0.1.

Availability of data and materials

All data generated or analyzed during this study are included in this published article and its supplementary information files. The raw microscopy datasets are available from the corresponding author on reasonable request.

Abbreviations

LpRs:: Lipophorin receptors
LpR1:: Lipophorin receptor 1
LpR2:: Lipophorin receptor 2
MB:: Mushroom bodies
LDL-R:: Low-density lipoprotein receptor
ApoE:: Apolipoprotein E
ApoB:: Apolipoprotein B
LNv:: Ventral lateral neurons
CNS:: Central nervous system
Dab1:: Disabled 1
CS + :: Conditioned stimulus
US:: Unconditioned stimulus
RAP:: Receptor-associated protein
Dab:: Disabled

References

Lane-Donovan C, Herz J. ApoE, ApoE receptors, and the synapse in Alzheimer’s disease. Trends Endocrinol Metab. 2017;28:273–84.
Article CAS PubMed PubMed Central Google Scholar
Rodenburg K, Smolenaars M, Vanhoof D, Vanderhorst D. Sequence analysis of the non-recurring C-terminal domains shows that insect lipoprotein receptors constitute a distinct group of LDL receptor family members. Insect Biochem Mol Biol. 2006;36:250–63.
Article CAS PubMed Google Scholar
Herz J, Bock HH. Lipoprotein receptors in the nervous system. Annu Rev Biochem. 2002;71:405–34.
Article CAS PubMed Google Scholar
Go G-W, Mani A. Low-density Lipoprotein receptor (LDLR) Family orchestrates cholesterol Homeostasis. Yale J Biol Med. 2012;85:19–28.
CAS PubMed PubMed Central Google Scholar
Zanoni P, Velagapudi S, Yalcinkaya M, Rohrer L, von Eckardstein A. Endocytosis of lipoproteins. Atherosclerosis. 2018;275:273–95.
Article CAS PubMed Google Scholar
Beffert U, Stolt PC, Herz J. Functions of lipoprotein receptors in neurons. J Lipid Res. 2004;45:403–9.
Article CAS PubMed Google Scholar
Dlugosz P, Nimpf J. The Reelin receptors apolipoprotein E receptor 2 (ApoER2) and VLDL receptor. Int J Mol Sci. 2018;19:3090.
Article CAS PubMed Central Google Scholar
He X, Semenov M, Tamai K, Zeng X. LDL receptor-related proteins 5 and 6 in Wnt/β-catenin signaling: arrows point the way. Development. 2004;131:1663–77.
Article CAS PubMed Google Scholar
Tamai K, Semenov M, Kato Y, Spokony R, Liu C, Katsuyama Y, et al. LDL-receptor-related proteins in Wnt signal transduction. Nature. 2000;407:530–5.
Article CAS PubMed Google Scholar
Wehrli M, Dougan ST, Caldwell K, O’Keefe L, Schwartz S, Vaizel-Ohayon D, et al. arrow encodes an LDL-receptor-related protein essential for Wingless signalling. Nature. 2000;407:527–30.
Article CAS PubMed Google Scholar
Riedel F, Vorkel D, Eaton S. Megalin-dependent Yellow endocytosis restricts melanization in the Drosophila cuticle. Development. 2011;138:149–58.
Article CAS PubMed Google Scholar
Rodenburg K, Van der Horst D. Lipoprotein-mediated lipid transport in insects: Analogy to the mammalian lipid carrier system and novel concepts for the functioning of LDL receptor family members. Biochim Biophys Acta BBA - Mol Cell Biol Lipids. 2005;1736:10–29.
CAS Google Scholar
Parra-Peralbo E, Culi J. Drosophila lipophorin receptors mediate the uptake of neutral lipids in oocytes and imaginal disc cells by an endocytosis-independent mechanism. PLoS Genet. 2011;7:e1001297.
Article CAS PubMed PubMed Central Google Scholar
Soukup SF, Culi J, Gubb D. Uptake of the necrotic Serpin in Drosophila melanogaster via the Lipophorin Receptor-1. PLoS Genet. 2009;5:e1000532.
Article CAS PubMed PubMed Central Google Scholar
Huang R, Song T, Su H, Lai Z, Qin W, Tian Y, et al. High-fat diet enhances starvation-induced hyperactivity via sensitizing hunger-sensing neurons in Drosophila. eLife. 2020;9:e53103.
Article CAS PubMed PubMed Central Google Scholar
Matsuo N, Nagao K, Suito T, Juni N, Kato U, Hara Y, et al. Different mechanisms for selective transport of fatty acids using a single class of lipoprotein in Drosophila. J Lipid Res. 2019;60:1199–211.
Article CAS PubMed PubMed Central Google Scholar
Rodríguez-Vázquez M, Vaquero D, Parra-Peralbo E, Mejía-Morales JE, Culi J. Drosophila lipophorin receptors recruit the lipoprotein LTP to the plasma membrane to mediate lipid uptake. PLOS Genet. 2015;11:e1005356.
Yin J, Spillman E, Cheng ES, Short J, Chen Y, Lei J, Gibbs M, Rosenthal JS, Sheng C, Chen YX, Veerasammy K. Brain-specific lipoprotein receptors interact with astrocyte derived apolipoprotein and mediate neuron-glia lipid shuttling. Nat Commun. 2021;12:2408.
Article CAS PubMed PubMed Central Google Scholar
Yin J, Gibbs M, Long C, Rosenthal J, Kim HS, Kim A, Sheng C, Ding P, Javed U, Yuan Q. Transcriptional regulation of lipophorin receptors supports neuronal adaptation to chronic elevations of activity. Cell Rep. 2018;25:1181-1192.e4.
Article CAS PubMed PubMed Central Google Scholar
Sepp KJ, Hong P, Lizarraga SB, Liu JS, Mejia LA, Walsh CA, et al. Identification of neural outgrowth genes using genome-wide RNAi. PLoS Genet. 2008;4:e1000111.
Andersen OM, Benhayon D, Curran T, Willnow TE. Differential binding of ligands to the apolipoprotein E receptor 2. Biochemistry. 2003;42:9355–64.
Article CAS PubMed Google Scholar
Benhayon D, Magdaleno S, Curran T. Binding of purified Reelin to ApoER2 and VLDLR mediates tyrosine phosphorylation of Disabled-1. Mol Brain Res. 2003;112:33–45.
Article CAS PubMed Google Scholar
D’Arcangelo G, Homayouni R, Keshvara L, Rice DS, Sheldon M, Curran T. Reelin is a ligand for lipoprotein receptors. Neuron. 1999;24:471–9.
Article PubMed Google Scholar
Yasui N, Nogi T, Takagi J. Structural basis for specific recognition of Reelin by its receptors. Structure. 2010;18:320–31.
Article CAS PubMed Google Scholar
Beffert U, Weeber EJ, Durudas A, Qiu S, Masiulis I, Sweatt JD, et al. Modulation of synaptic plasticity and memory by Reelin involves differential splicing of the lipoprotein receptor Apoer2. Neuron. 2005;47:567–79.
Article CAS PubMed Google Scholar
D’Arcangelo GG, Miao S-C, Scares HD, Morgan JI, Curran T. A protein related to extracellular matrix proteins deleted in the mouse mutant reeler. Nature. 1995;374:719–23.
Article PubMed Google Scholar
Knuesel I. Reelin-mediated signaling in neuropsychiatric and neurodegenerative diseases. Prog Neurobiol. 2010;91:257–74.
Article CAS PubMed Google Scholar
Ranaivoson FM, von Daake S, Comoletti D. Structural insights into Reelin function: present and future. Front Cell Neurosci. 2016;10:137.
Article CAS PubMed PubMed Central Google Scholar
Santana J, Marzolo M-P. The functions of Reelin in membrane trafficking and cytoskeletal dynamics: implications for neuronal migration, polarization and differentiation. Biochem J. 2017;474:3137–65.
Article CAS PubMed Google Scholar
Trommsdorff M, Gotthardt M, Hiesberger T, Shelton J, Stockinger W, Nimpf J, et al. Reeler/disabled-like disruption of neuronal migration in knockout mice lacking the VLDL receptor and ApoE receptor 2. Cell. 1999;97:689–701.
Article CAS PubMed Google Scholar
Weeber EJ, Beffert U, Jones C, Christian JM, Förster E, Sweatt JD, et al. Reelin and ApoE receptors cooperate to enhance hippocampal synaptic plasticity and learning. J Biol Chem. 2002;277:39944–52.
Article CAS PubMed Google Scholar
Howell BW. Mouse disabled (mDab1): a Src binding protein implicated in neuronal development. EMBO J. 1997;16:121–32.
Article CAS PubMed PubMed Central Google Scholar
Kawasaki F, Iyer J, Posey LL, Sun CE, Mammen SE, Yan H, et al. The DISABLED protein functions in CLATHRIN-mediated synaptic vesicle endocytosis and exoendocytic coupling at the active zone. Proc Natl Acad Sci. 2011;108:E222–9.
Article CAS PubMed PubMed Central Google Scholar
Yun M, Keshvara L, Park C-G, Dickerson JB, Zheng J, Rock CO, et al. Crystal structures of the Dab homology domains of mouse disabled 1 and 2. J Biol Chem. 2003;278:36572–81.
Article CAS PubMed Google Scholar
Hiesberger T, Trommsdorff M, Howell BW, Goffinet A, Mumby MC, Cooper JA, et al. Direct binding of Reelin to VLDL receptor and ApoE receptor 2 induces tyrosine phosphorylation of disabled-1 and modulates tau phosphorylation. Neuron. 1999;24:481–9.
Article CAS PubMed Google Scholar
Hendricks JC, Finn SM, Panckeri KA, Chavkin J, Williams JA, Sehgal A, et al. Rest in Drosophila is a sleep-like state. Neuron. 2000;25:129–38.
Article CAS PubMed Google Scholar
Shaw PJ. Correlates of sleep and waking in Drosophila melanogaster. Science. 2000;287:1834–7.
Article CAS PubMed Google Scholar
Haynes PR, Christmann BL, Griffith LC. A single pair of neurons links sleep to memory consolidation in Drosophila melanogaster. ELife. 2015;4:e03868.
Article PubMed Central Google Scholar
Martin J-R, Ernst R, Heisenberg M. Mushroom bodies suppress locomotor activity in Drosophila melanogaster. Learn Mem. 1998;5:13.
Article Google Scholar
Pitman JL, McGill JJ, Keegan KP, Allada R. A dynamic role for the mushroom bodies in promoting sleep in Drosophila. Nature. 2006;441:753–6.
Article CAS PubMed Google Scholar
Sitaraman D, Aso Y, Jin X, Chen N, Felix M, Rubin GM, et al. Propagation of homeostatic sleep signals by segregated synaptic microcircuits of the Drosophila Mushroom Body. Curr Biol. 2015;25:2915–27.
Article CAS PubMed PubMed Central Google Scholar
Vogt K, Schnaitmann C, Dylla KV, Knapek S, Aso Y, Rubin GM, et al. Shared mushroom body circuits underlie visual and olfactory memories in Drosophila. eLife. 2014;3:e02395.
Article PubMed PubMed Central Google Scholar
Aso Y, Grübel K, Busch S, Friedrich AB, Siwanowicz I, Tanimoto H. The Mushroom body of adult Drosophila characterized by GAL4 drivers. J Neurogenet. 2009;23:156–72.
Article CAS PubMed Google Scholar
Heisenberg M. Mushroom body memoir: from maps to models. Nat Rev Neurosci. 2003;4:266–75.
Article CAS PubMed Google Scholar
Crittenden JR, Skoulakis EMC, Han K-A, Kalderon D, Davis RL. Tripartite mushroom body architecture revealed by antigenic markers. Learn Mem. 1998;5:38–51.
Article CAS PubMed PubMed Central Google Scholar
Huang C, Zheng X, Zhao H, Li M, Wang P, Xie Z, et al. A permissive role of mushroom body α/β core neurons in long-term memory consolidation in Drosophila. Curr Biol. 2012;22:1981–9.
Article CAS PubMed Google Scholar
Pascual A. Localization of long-term memory within the Drosophila mushroom body. Science. 2001;294:1115–7.
Article CAS PubMed Google Scholar
Zwarts L, Vanden Broeck L, Cappuyns E, Ayroles JF, Magwire MM, Vulsteke V, et al. The genetic basis of natural variation in mushroom body size in Drosophila melanogaster. Nat Commun. 2015;6:10115.
Article CAS PubMed Google Scholar
Connolly JB, Roberts IJH, Armstrong JD, Kaiser K, Forte M, Tully T, et al. Associative learning disrupted by impaired Gs signaling in Drosophila Mushroom Bodies. Science. 1996;274:2104–7.
Article CAS PubMed Google Scholar
Martín-Peña A, Acebes A, Rodríguez J-R, Chevalier V, Casas-Tinto S, Triphan T, et al. Cell types and coincident synapses in the ellipsoid body of Drosophila. Eur J Neurosci. 2014;39:1586–601.
Article PubMed Google Scholar
Omoto JJ, Nguyen B-CM, Kandimalla P, Lovick JK, Donlea JM, Hartenstein V. Neuronal constituents and putative interactions within the Drosophila ellipsoid body neuropil. Front Neural Circuits. 2018;12:103.
Article CAS PubMed PubMed Central Google Scholar
Zhang Z, Li X, Guo J, Li Y, Guo A. Two clusters of GABAergic ellipsoid body neurons modulate olfactory labile memory in Drosophila. J Neurosci. 2013;33:5175–81.
Article CAS PubMed PubMed Central Google Scholar
Nagarkar-Jaiswal S, Lee P-T, Campbell ME, Chen K, Anguiano-Zarate S, Cantu Gutierrez M, et al. A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila. eLife. 2015;4:e05338.
Article PubMed Central Google Scholar
Kunz T, Kraft KF, Technau GM, Urbach R. Origin of Drosophila mushroom body neuroblasts and generation of divergent embryonic lineages. Development. 2012;139:2510–22.
Article CAS PubMed Google Scholar
Lee T, Lee A, Luo L. Clonal analysis of the mushroom bodies. Development. 1999;126:4065–76.
Article CAS PubMed Google Scholar
D’Arcangelo G. Reelin in the years: controlling neuronal migration and maturation in the mammalian brain. Adv Neurosci. 2014;2014:1–19.
Article Google Scholar
Jossin Y, Goffinet AM. Reelin Signals through phosphatidylinositol 3-kinase and Akt to control cortical development and through mTor to regulate dendritic growth. Mol Cell Biol. 2007;27:7113–24.
Article CAS PubMed PubMed Central Google Scholar
Matsuki T, Pramatarova A, Howell BW. Reduction of Crk and CrkL expression blocks reelin-induced dendritogenesis. J Cell Sci. 2008;121:1869–75.
Article CAS PubMed Google Scholar
Niu S, Renfro A, Quattrocchi CC, Sheldon M, D’Arcangelo G. Reelin promotes hippocampal dendrite development through the VLDLR/ApoER2-Dab1 pathway. Neuron. 2004;41:71–84.
Article CAS PubMed Google Scholar
Sotelo P, Farfán P, Benitez ML, Bu G, Marzolo M-P. Sorting Nexin 17 regulates ApoER2 recycling and Reelin signaling. Wanjin H, editor. PLoS One. 2014;9:e93672.
Article CAS PubMed PubMed Central Google Scholar
Ampuero E, Jury N, Härtel S, Marzolo M-P, van Zundert B. Interfering of the Reelin/ApoER2/PSD95 signaling axis reactivates dendritogenesis of mature hippocampal neurons: Reelin signaling maintains adult network stability. J Cell Physiol. 2017;232:1187–99.
Article CAS PubMed Google Scholar
Bu G, Marzolo MP. Role of RAP in the biogenesis of lipoprotein receptors. Trends Cardiovasc Med. 2000;10:148–55.
Article CAS PubMed Google Scholar
Battey FD, Gåfvels ME, FitzGerald DJ, Argraves WS, Chappell DA, Strauss JF, et al. The 39-kDa receptor-associated protein regulates ligand binding by the very low density lipoprotein receptor. J Biol Chem. 1994;269:23268–73.
Article CAS PubMed Google Scholar
Stockinger W, Hengstschläger-Ottnad E, Novak S, Matus A, Hüttinger M, Bauer J, et al. The low density lipoprotein receptor gene family. J Biol Chem. 1998;273:32213–21.
Article CAS PubMed Google Scholar
Van Hoof D. Insect lipoprotein follows a transferrin-like recycling pathway that is mediated by the insect LDL receptor homologue. J Cell Sci. 2002;115:4001–12.
Article CAS PubMed Google Scholar
Keshvara L, Benhayon D, Magdaleno S, Curran T. Identification of Reelin-induced sites of tyrosyl phosphorylation on disabled 1. J Biol Chem. 2001;276:16008–14.
Article CAS PubMed Google Scholar
Howell BW, Hawkes R, Soriano P, Cooper JA. Neuronal position in the developing brain is regulated by mouse disabled-1. Nature. 1997;389:733–7.
Article CAS PubMed Google Scholar
Song JK, Kannan R, Merdes G, Singh J, Mlodzik M, Giniger E. Disabled is a bona fide component of the Abl signaling network. Development. 2010;137:3719–27.
Article CAS PubMed PubMed Central Google Scholar
McGuire SE. The role of Drosophila mushroom body signaling in olfactory memory. Science. 2001;293:1330–3.
Article CAS PubMed Google Scholar
Hourcade B, Muenz TS, Sandoz JC, Rossler W, Devaud JM. Long-term memory leads to synaptic reorganization in the mushroom bodies: a memory trace in the insect brain? J Neurosci. 2010;30:6461–5.
Article CAS PubMed PubMed Central Google Scholar
Maza FJ, Sztarker J, Shkedy A, Peszano VN, Locatelli FF, Delorenzi A. Context-dependent memory traces in the crab’s mushroom bodies: functional support for a common origin of high-order memory centers. Proc Natl Acad Sci. 2016;113:E7957–65.
Article CAS PubMed PubMed Central Google Scholar
Owald D, Waddell S. Olfactory learning skews mushroom body output pathways to steer behavioral choice in Drosophila. Curr Opin Neurobiol. 2015;35:178–84.
Article CAS PubMed PubMed Central Google Scholar
Wolff GH, Strausfeld NJ. Genealogical correspondence of a forebrain centre implies an executive brain in the protostome–deuterostome bilaterian ancestor. Philos Trans R Soc B Biol Sci. 2016;371:20150055.
Article CAS Google Scholar
Whited JL, Robichaux MB, Yang JC, Garrity PA. Ptpmeg is required for the proper establishment and maintenance of axon projections in the central brain of Drosophila. Development. 2007;134:43–53.
Article CAS PubMed Google Scholar
Jia M, Meng D, Chen M, Li T, Zhang YQ, Yao A. Drosophila homolog of the intellectual disability-related long-chain acyl-CoA synthetase 4 is required for neuroblast proliferation. J Genet Genomics. 2019;46:5–17.
Article PubMed Google Scholar
Stoeckli ET. Understanding axon guidance: are we nearly there yet? Development. 2018;145:dev151415.
Article CAS PubMed Google Scholar
Faini G, Del Bene F, Albadri S. Reelin functions beyond neuronal migration: from synaptogenesis to network activity modulation. Curr Opin Neurobiol. 2021;66:135–43.
Article CAS PubMed Google Scholar
Del Río JA, Heimrich B, Borrell V, Förster E, Drakew A, Alcántara S, et al. A role for Cajal-Retzius cells and reelin in the development of hippocampal connections. Nature. 1997;385:70–4.
Article PubMed Google Scholar
Di Donato V, De Santis F, Albadri S, Auer TO, Duroure K, Charpentier M, et al. An attractive reelin gradient establishes synaptic lamination in the vertebrate visual system. Neuron. 2018;97:1049-1062.e6.
Article CAS PubMed Google Scholar
Rice DS, Nusinowitz S, Azimi AM, Martı́nez A, Soriano E, Curran T. The Reelin pathway modulates the structure and function of retinal synaptic circuitry. Neuron. 2001;31:929–41.
Article CAS PubMed Google Scholar
Borrell V, Del Rı́o JA, Alcántara S, Derer M, Martı́nez A, D’Arcangelo G, et al. Reelin regulates the development and synaptogenesis of the layer-specific entorhino-hippocampal connections. J Neurosci. 1999;19:1345–58.
Article CAS PubMed PubMed Central Google Scholar
Borrell V, Pujadas L, Simó S, Durà D, Solé M, Cooper JA, et al. Reelin and mDab1 regulate the development of hippocampal connections. Mol Cell Neurosci. 2007;36:158–73.
Article CAS PubMed Google Scholar
Chai X, Förster E, Zhao S, Bock HH, Frotscher M. Reelin acts as a stop signal for radially migrating neurons by inducing phosphorylation of n-cofilin at the leading edge. Commun Integr Biol. 2009;2:375–7.
Article CAS PubMed PubMed Central Google Scholar
Ng J. TGFβ signals regulate axonal development through distinct Smad-independent mechanisms. Development. 2008;135:4025–35.
Article CAS PubMed Google Scholar
Ng J, Luo L. Rho GTPases regulate axon growth through convergent and divergent signaling pathways. Neuron. 2004;44:779–93.
Article CAS PubMed Google Scholar
Ng J, Nardine T, Harms M, Tzu J, Goldstein A, Sun Y, et al. Rac GTPases control axon growth, guidance and branching. Nature. 2002;416:442–7.
Article CAS PubMed Google Scholar
Boyle M, Nighorn A, Thomas JB. Drosophila Eph receptor guides specific axon branches of mushroom body neurons. Development. 2006;133:1845–54.
Article CAS PubMed Google Scholar
Reynaud E, Lahaye LL, Boulanger A, Petrova IM, Marquilly C, Flandre A, et al. Guidance of Drosophila mushroom body axons depends upon DRL-Wnt receptor cleavage in the brain dorsomedial lineage precursors. Cell Rep. 2015;11:1293–304.
Article CAS PubMed Google Scholar
Heisenberg M, Borst A, Wagner S, Byers D. The mushroom body mutants are deficient in olfactory learning. J Neurogenet. 1985;2:1–30.
Article CAS PubMed Google Scholar
Kosacka J, Gericke M, Nowicki M, Kacza J, Borlak J, Spanel-Borowski K. Apolipoproteins D and E3 exert neurotrophic and synaptogenic effects in dorsal root ganglion cell cultures. Neuroscience. 2009;162:282–91.
Article CAS PubMed Google Scholar
Liu L, MacKenzie KR, Putluri N, Maletić-Savatić M, Bellen HJ. The glia-neuron lactate shuttle and elevated ROS promote lipid synthesis in neurons and lipid droplet accumulation in glia via APOE/D. Cell Metab. 2017;26:719-737.e6.
Article CAS PubMed PubMed Central Google Scholar
Howell BW, Lanier LM, Frank R, Gertler FB, Cooper JA. The disabled 1 phosphotyrosine-binding domain binds to the internalization signals of transmembrane glycoproteins and to phospholipids. Mol Cell Biol. 1999;19:5179–88.
Article CAS PubMed PubMed Central Google Scholar
Gertler FB, Hill KK, Clark MJ, Hoffmann FM. Dosage-sensitive modifiers of Drosophila abl tyrosine kinase function: prospero, a regulator of axonal outgrowth, and disabled, a novel tyrosine kinase substrate. Genes Dev. 1993;7:441–53.
Article CAS PubMed Google Scholar
Beffert U, Morfini G, Bock HH, Reyna H, Brady ST, Herz J. Reelin-mediated signaling locally regulates protein kinase B/Akt and glycogen synthase kinase 3β. J Biol Chem. 2002;277:49958–64.
Article CAS PubMed Google Scholar
Chen K. Interaction between Dab1 and CrkII is promoted by Reelin signaling. J Cell Sci. 2004;117:4527–36.
Article CAS PubMed Google Scholar
Howell BW, Herrick TM, Hildebrand JD, Zhang Y, Cooper JA. Dab1 tyrosine phosphorylation sites relay positional signals during mouse brain development. Curr Biol. 2000;10:877–85.
Article CAS PubMed Google Scholar
Leemhuis J, Bouche E, Frotscher M, Henle F, Hein L, Herz J, et al. Reelin signals through apolipoprotein E receptor 2 and Cdc42 to increase growth cone motility and filopodia formation. J Neurosci. 2010;30:14759–72.
Article CAS PubMed PubMed Central Google Scholar
Manoharan M, Muhammad SA, Sowdhamini R. Sequence analysis and evolutionary studies of Reelin proteins. Bioinforma Biol Insights. 2015;9:BBI.S26530.
Article Google Scholar
Tully T, Quinn WG. Classical conditioning and retention in normal and mutant Drosophila melanogaster. J Comp Physiol [A]. 1985;157:263–77.
Article CAS Google Scholar
Hidalgo S, Campusano JM, Hodge JJL. Assessing olfactory, memory, social and circadian phenotypes associated with schizophrenia in a genetic model based on Rim. Transl Psychiatry. 2021;11:292.
Article CAS PubMed PubMed Central Google Scholar
Geissmann Q, Garcia Rodriguez L, Beckwith EJ, Gilestro GF. Rethomics: An R framework to analyse high-throughput behavioural data. Flack JC, editor. PLOS ONE. 2019;14:e020933.
Article CAS Google Scholar
Leyton V, Goles NI, Fuenzalida-Uribe N, Campusano JMV. Octopamine and Dopamine differentially modulate the nicotine-induced calcium response in Drosophila mushroom body kenyon cells. Neurosci Lett. 2014;560:16–20.
Article CAS PubMed Google Scholar
Sicaeros B, Campusano JM, O’Dowd DK. Primary neuronal cultures from the brains of late stage Drosophila pupae. J Vis Exp. 2007;4:e200.
D’Arcangelo G, Nakajima K, Miyata T, Ogawa M, Mikoshiba K, Curran T. Reelin is a secreted glycoprotein recognized by the CR-50 monoclonal antibody. J Neurosci. 1997;17:23–31.
Article PubMed PubMed Central Google Scholar
Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9:676–82.
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We are very grateful to Dr. Joaquim Culi (Universidad Autónoma de Madrid, Spain) for providing us the antibodies to detect LpR1 and the flies and the plasmids to express the different isoforms of LpRs. We thank Dr. Hugo Bellen, Dr. Lindsey D Goodman, and Dr. Oguz Kanca for sharing fly lines and for their comments and suggestions. We are indebted to Dr. Joachim Herz (University of Texas Southwestern, USA), who kindly provided the HEK293 Reelin-producing cells. We also thank Gloria Loyola for her technical support and Dr. Estela Andrés for access to the RT-qPCR apparatus. Many thanks to Dr. James Hodge (University of Bristol, UK) for giving us access to the olfactory learning and memory apparatus and Dr. Alfredo Ghezzi (Universidad de Puerto Rico, Rio Piedras) for allowing us to use the circadian setup. We also thank Dr. Serge Birman for providing us access to confocal scanning microscope and comments on results. We acknowledge the help provided by the Advanced Microscopy Facility UMA BIO UC.

Funding

This study was supported by FONDECYT grants 1200393 to MPM, 1191424 to CO, and 1141233 to JMC. FR-C and SH were supported by ANID Doctoral fellowships Nº21180582 and 21161611, respectively.

Author information

Authors and Affiliations

Laboratorio de Tráfico Intracelular y Señalización, Departamento de Biología Celular y Molecular, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago, Chile
Francisca Rojo-Cortés, Candy B. Roa & María-Paz Marzolo
Laboratorio Neurogenética de la Conducta, Departamento de Biología Celular y Molecular, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago, Chile
Francisca Rojo-Cortés, Victoria Tapia-Valladares, Candy B. Roa, Sergio Hidalgo & Jorge M. Campusano
Department of Biology, University of Puerto Rico, Rio Piedras, San Juan, Puerto Rico
Nicolás Fuenzalida-Uribe
Department of Entomology and Nematology, College of Agricultural and Environmental Sciences, University of California, Davis, USA
Sergio Hidalgo
Laboratorio Neurodesarrollo, Departamento de Biología Celular y Molecular, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago, Chile
María-Constanza González-Ramírez & Carlos Oliva

Authors

Francisca Rojo-Cortés
View author publications
You can also search for this author in PubMed Google Scholar
Nicolás Fuenzalida-Uribe
View author publications
You can also search for this author in PubMed Google Scholar
Victoria Tapia-Valladares
View author publications
You can also search for this author in PubMed Google Scholar
Candy B. Roa
View author publications
You can also search for this author in PubMed Google Scholar
Sergio Hidalgo
View author publications
You can also search for this author in PubMed Google Scholar
María-Constanza González-Ramírez
View author publications
You can also search for this author in PubMed Google Scholar
Carlos Oliva
View author publications
You can also search for this author in PubMed Google Scholar
Jorge M. Campusano
View author publications
You can also search for this author in PubMed Google Scholar
María-Paz Marzolo
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

M-P.M, JMC, and F.R–C conceived and designed the study. The formal analysis where developed by F.R–C., N.F-U, and SH. F.R–C., V.T-V., N.F-U. SH, M-C.G-R., and CBR conducted the experiments. JMC, M-P.M., and CO. provided the resources for the study. F.R–C. wrote the original manuscript. M-P.M., JMC, F.R–C., and CO. reviewed and edited the manuscript. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Jorge M. Campusano or María-Paz Marzolo.

Ethics declarations

Ethics approval and consent to participate

All procedures were approved by Comité de Ética y Seguridad, Pontificia Universidad Católica de Chile (ID Protocol: 190806006).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1:

Fig. S1. Verification of reduction in LpR1 or LpR2 expression in mutant and knockdown animals. Fig. S2. Sensory controls in LpR1 and LpR2 mutant flies. Fig. S3. Knocking down LpR1 or LpR2 in MB neurons using the OK107 driver results in altered MB associated behaviors. Fig. S4. Reduced expression of LpR1 or LpR2 results in altered MB structure. Fig. S5. LpR1 expression in w¹¹¹⁸ adulthood flies. Fig. S6. LpRs are expressed in primary culture neurons from pupal brain. Fig. S7. Schematic representation of LpRs isoforms studied. Fig. S8. Control of the Reelin internalization. Fig. S9. Verification of reduction in Dab expression in mutant and knockdown animals. Fig. S10. Sensory controls in Dab mutant flies. Fig. S11. Flies knockdown for Dab in the MB presents normal MB associated behaviors.

Additional file 2:

Table S1. Phenotypes of flies haploinsufficient or knockout of LpR1 or LpR2 and after the re-expression of LpR2. Table S2. Phenotypes in insertion mutant flies for LpR1 and LpR2 and after the re-expression of LpR2. Table S3. Phenotypes of flies that express RNAi against LpR1 or LpR2 in MB neurons under the control of the c309-Gal4 driver. Table S4. Phenotypes of flies expressing RNAi against LpR1 or LpR2 in MB neurons under the control of the OK107 driver. Table S5. Phenotypes of mutant flies lacking a copy of Dab. Table S6. Phenotypes of flies that express an RNAi against Dab in MB neurons directed by c309-Gal4. Table S7. Phenotypes in the evaluation of genetic interaction between LpR1 and Dab.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article

Rojo-Cortés, F., Fuenzalida-Uribe, N., Tapia-Valladares, V. et al. Lipophorin receptors regulate mushroom body development and complex behaviors in Drosophila. BMC Biol 20, 198 (2022). https://doi.org/10.1186/s12915-022-01393-1

Download citation

Received: 07 December 2021
Accepted: 17 August 2022
Published: 07 September 2022
DOI: https://doi.org/10.1186/s12915-022-01393-1

Lipophorin receptors regulate mushroom body development and complex behaviors in Drosophila

Abstract

Background

Results

Conclusions

Background

Results

Fly mutants for lipophorin receptors exhibit impaired behaviors associated with MB function

Lipophorin receptors contribute to adult mushroom body organization

Lipophorin receptor expression in mushroom body at distinct developmental stages

LpRs contribute to Drosophila MB neurite development

LpRs long isoforms are required to mediate Reelin internalization

Dab is required for Reelin-induced responses in MB neurons

Dab is required for MB development and function

Discussion

LpRs are required for adult MB structure and operation

Hints on a novel function for LpRs

Conclusions

Methods

Drosophila stocks

Measurement of mRNA levels

Aversive olfactory conditioning

Locomotor and sleep analysis

Fly brain immunohistochemistry

Cell culture immunocytochemistry

Preparation of primary cultures of pupal brain neurons

Reelin production

Reelin treatments for Sholl analysis

Internalization assay

Analyses

Availability of data and materials

Abbreviations

References

Acknowledgements

Funding

Author information

Authors and Affiliations

Contributions

Corresponding authors

Ethics declarations

Ethics approval and consent to participate

Consent for publication

Competing interests

Additional information

Publisher’s Note

Supplementary Information

Additional file 1:

Additional file 2:

Rights and permissions

About this article

Cite this article

Share this article

Keywords

BMC Biology

Contact us